ID: 1181023785

View in Genome Browser
Species Human (GRCh38)
Location 22:20116611-20116633
Sequence ACCCCATCTGTCCCCACACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 238}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181023785_1181023792 2 Left 1181023785 22:20116611-20116633 CCCTGTGTGGGGACAGATGGGGT 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1181023792 22:20116636-20116658 TAGGGTGAGGACTAGGCCCTGGG 0: 1
1: 0
2: 1
3: 13
4: 146
1181023785_1181023790 -5 Left 1181023785 22:20116611-20116633 CCCTGTGTGGGGACAGATGGGGT 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1181023790 22:20116629-20116651 GGGGTGCTAGGGTGAGGACTAGG 0: 1
1: 0
2: 3
3: 23
4: 349
1181023785_1181023799 29 Left 1181023785 22:20116611-20116633 CCCTGTGTGGGGACAGATGGGGT 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1181023799 22:20116663-20116685 TGGCCCCCCAAGCTTCCTTATGG 0: 1
1: 0
2: 1
3: 9
4: 111
1181023785_1181023791 1 Left 1181023785 22:20116611-20116633 CCCTGTGTGGGGACAGATGGGGT 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1181023791 22:20116635-20116657 CTAGGGTGAGGACTAGGCCCTGG 0: 1
1: 1
2: 0
3: 19
4: 226
1181023785_1181023794 4 Left 1181023785 22:20116611-20116633 CCCTGTGTGGGGACAGATGGGGT 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1181023794 22:20116638-20116660 GGGTGAGGACTAGGCCCTGGGGG 0: 1
1: 0
2: 3
3: 21
4: 277
1181023785_1181023793 3 Left 1181023785 22:20116611-20116633 CCCTGTGTGGGGACAGATGGGGT 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1181023793 22:20116637-20116659 AGGGTGAGGACTAGGCCCTGGGG 0: 1
1: 0
2: 1
3: 25
4: 327
1181023785_1181023795 9 Left 1181023785 22:20116611-20116633 CCCTGTGTGGGGACAGATGGGGT 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1181023795 22:20116643-20116665 AGGACTAGGCCCTGGGGGCCTGG 0: 1
1: 0
2: 1
3: 40
4: 368
1181023785_1181023800 30 Left 1181023785 22:20116611-20116633 CCCTGTGTGGGGACAGATGGGGT 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1181023800 22:20116664-20116686 GGCCCCCCAAGCTTCCTTATGGG 0: 1
1: 0
2: 2
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181023785 Original CRISPR ACCCCATCTGTCCCCACACA GGG (reversed) Exonic
900149305 1:1171250-1171272 ACCCCCTCTCCCCCCACACAAGG + Intergenic
901164862 1:7212362-7212384 CCCCCATCCCTCCCCACACATGG + Intronic
901453648 1:9351319-9351341 ACCACATCTGGCCCTACAGAGGG - Intronic
901551964 1:10002115-10002137 ACCACATCTGGCCCTACACTGGG + Intronic
901571097 1:10161322-10161344 AGGCCATCTGCCTCCACACACGG + Intronic
904318529 1:29681576-29681598 ACCCCACCTGTCCCTGCACCTGG - Intergenic
905450865 1:38055294-38055316 ACCCCTTATCTCCACACACATGG + Intergenic
905799116 1:40832193-40832215 ACCCCACCTCTCCCCACCCAGGG - Intronic
906406385 1:45545673-45545695 GCCTCCTCTGTCGCCACACAAGG + Intergenic
908128949 1:61055352-61055374 ACCAAATCTGTTCCCATACATGG - Intronic
910609145 1:89121729-89121751 GCCCCTTCTGTCCGTACACACGG - Intronic
911260456 1:95679475-95679497 ACCACATCTCTCCCAACACTAGG + Intergenic
914675377 1:149904018-149904040 TCCCTACCTGTCCCCTCACAGGG - Exonic
915318991 1:155045827-155045849 TCCTCATCTATCCCCAAACATGG - Intronic
915319279 1:155047402-155047424 CCCCCATCTCTCCACACCCAAGG - Intronic
915327194 1:155086556-155086578 GCCCCATCTCTCCCCCCCCAGGG - Exonic
919927989 1:202202431-202202453 ACCCCATCTGGGCACACACCTGG + Intronic
920225940 1:204439070-204439092 CCCCCATTTCTCCCCTCACAGGG - Exonic
920733588 1:208511437-208511459 TCCCCATCTGCCCACACACAGGG + Intergenic
924183272 1:241460736-241460758 ACTCCATCTCATCCCACACACGG + Intergenic
1064788678 10:18929689-18929711 ACCCCACCAGTCCCAACAAATGG - Intergenic
1067051379 10:43023258-43023280 GCCCCATCCATCCCCACACTGGG - Intergenic
1067795015 10:49314651-49314673 AACCCATCTGGTGCCACACATGG - Intronic
1067896561 10:50187184-50187206 AAACTATCTGTCCCCAAACAGGG + Exonic
1067952411 10:50754849-50754871 AAACTATCTGTCCCCAAACAGGG - Intronic
1069566374 10:69466023-69466045 GCTCCCTCTATCCCCACACAAGG - Intronic
1069742185 10:70691816-70691838 ACTCCCTCTGTCCCCTCTCAGGG + Intronic
1070749061 10:78953260-78953282 ATCCCATCCGTCCCCCAACATGG + Intergenic
1070799852 10:79238959-79238981 ACCCCTCCTGTGTCCACACACGG - Intronic
1071324549 10:84499854-84499876 ACCCCATCTCTCTCTGCACAGGG + Intronic
1072693305 10:97585405-97585427 ACCCCATCTCTCTTTACACATGG + Intronic
1074447494 10:113532744-113532766 ACCCAATCTAACCACACACAGGG + Intergenic
1074696642 10:116055728-116055750 ACCCCAGCTGTCAGCACAGATGG - Intergenic
1075457175 10:122592362-122592384 ATCCCAGCTGTCATCACACACGG - Exonic
1076005705 10:126947009-126947031 ACCGCATCTCTCCCCAGTCATGG - Intronic
1077240734 11:1509118-1509140 CCAACAGCTGTCCCCACACAGGG + Intergenic
1077376865 11:2209336-2209358 ACCCCCTCTGGCCCCAGGCATGG + Intergenic
1078097894 11:8311726-8311748 ACCCCATCCGTCCCCTGCCAAGG + Intergenic
1078439317 11:11351069-11351091 ACTCCATCTGTCCCTATACCTGG - Intronic
1079980101 11:27142037-27142059 AACTCATATGTCCCCATACAAGG + Intergenic
1080050917 11:27858108-27858130 AAAGCATCTGTCTCCACACAGGG - Intergenic
1080429432 11:32184775-32184797 GCCCCTTCTGGCCCCTCACAAGG - Intergenic
1081274083 11:41125157-41125179 AGACCATCTGTCTCCAGACATGG + Intronic
1083270857 11:61571858-61571880 TCCCCATCTGACCCCATACCTGG - Intronic
1084178421 11:67435105-67435127 TCCCCATCCGTCCCCCCTCAGGG + Exonic
1085350087 11:75792630-75792652 ACCCCACCTGTGCCAACAGAAGG - Intronic
1088403452 11:109445971-109445993 ACCCCCTATCTCACCACACATGG - Intergenic
1088743837 11:112787991-112788013 ACCCCATATGTGTCCTCACATGG - Intergenic
1089457516 11:118634187-118634209 ACCCCCTCTGTACCCACTCCTGG + Intronic
1092002488 12:5044018-5044040 ACCCCAGCTCTCCCCAGAGAGGG + Exonic
1093914708 12:24788646-24788668 ACCCCAGCTTTCAGCACACAAGG + Intergenic
1094828562 12:34289499-34289521 ACCCCTGCGGACCCCACACAGGG + Intergenic
1094830658 12:34298669-34298691 ACCCCCGCGGTCCCCACGCAGGG - Intergenic
1096581711 12:52590034-52590056 ACCCCATCTCTCACCACGCATGG - Intronic
1097234554 12:57530390-57530412 ACCCAATCCTTCCCCACACCAGG + Exonic
1098953442 12:76665176-76665198 CTCCCATGTGTCCCCAAACAAGG + Intergenic
1100326158 12:93541939-93541961 CCCTCATCTGAACCCACACAAGG + Intergenic
1101046171 12:100808502-100808524 ACCCAACCTGTCGTCACACAGGG + Intronic
1101919250 12:108919276-108919298 ACCCCACCTGTACCCACACTTGG + Intronic
1103313304 12:120030111-120030133 AACACATCTGTCACCACACTTGG + Intronic
1103444697 12:120986999-120987021 ATCCCTTCTGTTCCCCCACAGGG + Intronic
1103701259 12:122849854-122849876 ACCCTGTCTGTCTTCACACAGGG + Exonic
1103905975 12:124327363-124327385 CCCCCGTCTGTCCCCACCCCCGG - Intronic
1103939243 12:124492972-124492994 GCCCCTGCTGCCCCCACACAAGG + Intronic
1104971894 12:132534537-132534559 GCCCCACATGTGCCCACACAGGG + Intronic
1105854908 13:24364411-24364433 ACCCCATCTGTCCCCTGCCCTGG + Intergenic
1106950761 13:34881064-34881086 TCCCCATCAGTCCTCACAAAAGG - Intergenic
1108448002 13:50528335-50528357 ACCACATCTGTCCCCACTTGTGG - Intronic
1108505046 13:51105255-51105277 GCCCCAGCTGTAACCACACAGGG - Intergenic
1111255572 13:85662944-85662966 ACCCCATCACTCTCCCCACATGG - Intergenic
1112585745 13:100716879-100716901 ACCCCCTCTCTCCCCACTCCAGG - Intergenic
1113040564 13:106100367-106100389 ACACCCTCTGTCCCCACCCTAGG + Intergenic
1117285535 14:54282795-54282817 ACCCCAAGTGTGCACACACATGG + Intergenic
1118316155 14:64727501-64727523 ACCCCACCTGCCCCCACCCCTGG + Intronic
1121331102 14:93050303-93050325 ACCTCCTCTCACCCCACACACGG - Intronic
1121431124 14:93889134-93889156 ACTTCATTTCTCCCCACACAGGG - Intergenic
1122268274 14:100556808-100556830 AACCCAGCTGTCCCCTCACTAGG - Intronic
1123010713 14:105348307-105348329 ACCCCAGCTGTCCCTGCACATGG - Intronic
1123067422 14:105625643-105625665 GCCCCATCTGTCTCCTCACCCGG - Intergenic
1123071439 14:105644367-105644389 GCCCCATCTGTCTCCTCACCCGG - Intergenic
1123076397 14:105669422-105669444 GCCCCATCTGTCTCCTCACCCGG - Intergenic
1123928208 15:25139717-25139739 ACCCAAACTGTAACCACACAGGG - Intergenic
1124657742 15:31522924-31522946 GCCCCATCTGTCTCCATACCAGG + Intronic
1128389902 15:67175738-67175760 ACCACACCTGTGCTCACACATGG - Intronic
1128987363 15:72231074-72231096 ACGCCATCAGTCCCCACCAAGGG - Exonic
1129720169 15:77873505-77873527 GCCCCAGCTGTCACCAGACAGGG - Intergenic
1132533719 16:466989-467011 GCCCCATGTGTCCCCATCCATGG - Intronic
1132753691 16:1471433-1471455 ACCCCGTCTGTGGCCACACTGGG + Intronic
1132828262 16:1915615-1915637 CCCCCATTTGCCCCCAGACAGGG + Intronic
1134250810 16:12572542-12572564 ACACCATCTGGCTCCTCACAGGG + Exonic
1134682384 16:16135315-16135337 CCTCCATCTGTCCCCACTTATGG + Intronic
1136067754 16:27770199-27770221 AACCCAAATGTCCCCAGACAAGG - Intronic
1136492139 16:30615611-30615633 GCACCAGCTGCCCCCACACAGGG - Intronic
1137251852 16:46747047-46747069 CCCCTAGCTGTCCCCAAACAGGG + Intronic
1137385992 16:48043007-48043029 ACCCCCCCTGTCCCAACAGACGG - Intergenic
1137392501 16:48093057-48093079 ACCCAATCTGTCTCTAGACATGG - Intronic
1137580792 16:49632400-49632422 TCCCCAGGTGTGCCCACACAGGG + Intronic
1138282228 16:55780697-55780719 AGCCAGTCTGTCCCCACACTCGG - Intergenic
1138286716 16:55815937-55815959 AGCCAGTCTGTCCCCACACTCGG + Intronic
1138977325 16:62223461-62223483 ACGCCAAGTGTACCCACACATGG + Intergenic
1141455464 16:84138707-84138729 ACCACAACTGTCCCCAAACTAGG + Intronic
1142118427 16:88373432-88373454 TCCCCATCCGCCTCCACACAGGG - Intergenic
1142680707 17:1546601-1546623 ACACTGTCTGTACCCACACATGG + Intronic
1143263958 17:5621681-5621703 ATCCCATCAGTCCCCACATATGG - Intergenic
1143316779 17:6038839-6038861 ACCCCCTCTGCCCCCACACCTGG - Intronic
1146659940 17:34658997-34659019 ACCTGTTCTGTCACCACACAGGG - Intergenic
1146695078 17:34902815-34902837 GCCCCATCTCCTCCCACACAAGG + Intergenic
1146941818 17:36848568-36848590 ACCCCATCTGCACCCCCACTAGG - Intergenic
1147726647 17:42569745-42569767 TCCCCAACTGTCCTTACACATGG + Intronic
1147988612 17:44320316-44320338 ACCCCACCTGTCCCCTGCCACGG + Intronic
1148105779 17:45118137-45118159 CACCCATCTGTCCACACACAGGG - Exonic
1148777005 17:50101647-50101669 ACCCCCTCTGCTCCCACACAGGG + Intronic
1150387616 17:64773954-64773976 GACCCACCTGTCCCCACTCAGGG - Intergenic
1151351606 17:73535151-73535173 CCCCCTGCTGTCCTCACACATGG - Intronic
1151951600 17:77357169-77357191 TCCCCATCTGCCCCCACACCTGG - Intronic
1152235194 17:79135014-79135036 ACCCCATCTGATCCCACAGATGG + Intronic
1152901254 17:82942345-82942367 ACCGTGTCAGTCCCCACACAGGG + Intronic
1154216686 18:12420872-12420894 TCCCCATCTGTCCTCCCAAAGGG + Intronic
1155063232 18:22247074-22247096 CCGCCATCAGTCCCCACAGAGGG + Intergenic
1156965502 18:43086609-43086631 ACCACATCTCTCTCCACAAAAGG + Intronic
1157735221 18:50042099-50042121 AACCAATCTGTCCCCACAAGTGG - Intronic
1159534676 18:69700788-69700810 ACCCCATCAGTCCAGACCCAGGG - Intronic
1160733837 19:652943-652965 AGCCCCTCTGTCCTCACACTTGG - Intronic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1160818400 19:1046780-1046802 ACCCCAGCCGTCCCCACCCCAGG + Exonic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161065432 19:2235326-2235348 ACTCCATCTTTCCCCGCAGAAGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161412261 19:4123459-4123481 ACCCCATCTTTTCCACCACAAGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161511567 19:4675113-4675135 ACCCCAGGAGTCCCCACAGATGG + Intergenic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161943258 19:7419025-7419047 ACCCCAGATGTACCCACACTCGG + Intronic
1161943265 19:7419055-7419077 ACCCCAGATGTACCCACACTCGG + Intronic
1161943278 19:7419114-7419136 ACCCCAGATGTACCCACACTCGG + Intronic
1161943293 19:7419174-7419196 ACCCCAGATGTACCCACACTCGG + Intronic
1161943316 19:7419262-7419284 ACCCCAGGTGTGCCCACACTCGG + Intronic
1163094116 19:15043248-15043270 AACCCACCTGCCTCCACACAGGG + Intergenic
1163370813 19:16900235-16900257 ACCCCATGGCTCCCCACCCAGGG + Intronic
1163594713 19:18214314-18214336 ACCCCAACTGTGACCCCACAGGG + Intronic
1165280412 19:34792572-34792594 ACCGCACCTGGCCCCTCACAAGG - Intergenic
1167037232 19:47001628-47001650 TCCCCAGCTGTCCCCACCAAGGG - Exonic
1167380747 19:49136697-49136719 TGTCCCTCTGTCCCCACACAGGG + Intronic
1167588383 19:50388156-50388178 AGCCCATCTGCCCCCACCCCTGG - Intronic
1168377394 19:55891890-55891912 AGCTCATTTGTCCCCACAAATGG + Intronic
1168524894 19:57080998-57081020 ACCTCATCTCTCCCCACAATTGG - Intergenic
925090430 2:1150825-1150847 ACCCCAGCTGCCTCCACACAGGG - Intronic
927101330 2:19789789-19789811 ACCACATCCGTCCCCACTCCAGG + Intergenic
931225051 2:60322241-60322263 ACCTCCTCCGTCCCCACAGAAGG - Intergenic
931670526 2:64643130-64643152 TCCCCGTCTGTCCCCGCACCAGG - Intronic
933222776 2:79709844-79709866 TCCCCATCTGGCCTCACAAAAGG - Intronic
934777905 2:96950578-96950600 GACCCACCTGTCCCCAGACAGGG + Intronic
934926612 2:98386349-98386371 ACCAGATCTGTCCCGACACATGG - Intronic
938804476 2:134793343-134793365 ACCCCATCTGGCTCCAGAGATGG - Intergenic
943851680 2:192731017-192731039 ACCACACCTGTCCTGACACATGG - Intergenic
947651158 2:231787038-231787060 TCCCCATCTGTCTCTTCACACGG + Intronic
948729206 2:239952665-239952687 AGACCACCTGTCACCACACATGG + Intronic
1168805567 20:670465-670487 ACCCCATCTCTCCCGGCAGAGGG + Intronic
1170329470 20:15192528-15192550 ACCTCATATGTCCACACACCTGG + Intronic
1170975325 20:21158763-21158785 CTCCCATCTCTCCCCACAGAGGG - Intronic
1171298854 20:24041950-24041972 CCCCCATCTGCTCCCACCCAGGG + Intergenic
1175442608 20:59002116-59002138 ACCGCATCTGGCCCCTCACTGGG - Intronic
1175970577 20:62684788-62684810 ACCCCAGCAATCCCCACACCTGG + Intronic
1175983370 20:62752493-62752515 CCCGCCTCTGTCCCCACACGTGG + Intronic
1176089372 20:63312187-63312209 CCCACATCTGCCCCCACACCAGG - Intronic
1177076381 21:16579854-16579876 ACACTTTCAGTCCCCACACAAGG - Intergenic
1178828303 21:36033815-36033837 AACCCATCTGTCCCCATCTAGGG - Intergenic
1179382241 21:40910594-40910616 ACCACATGTGTCCCTACACACGG - Intergenic
1179726103 21:43341929-43341951 ACCCCATGTGCCACCACACATGG - Intergenic
1181023785 22:20116611-20116633 ACCCCATCTGTCCCCACACAGGG - Exonic
1181761623 22:25062693-25062715 ACCCCATCTGCCCCTCCGCATGG + Intronic
1183280425 22:36929313-36929335 ACCCCCTGTGTCCACACAAAAGG + Intronic
1183483181 22:38075873-38075895 ACCCACTGTGTCCCCACACAGGG - Intergenic
1183833703 22:40434861-40434883 TCCCCATCTCTACCCACACTGGG + Intronic
1184710254 22:46245451-46245473 ATCCCAGCTGTTCCCACCCAGGG - Intronic
950170714 3:10837418-10837440 TCCCCATCTTTCCCAAGACAGGG + Intronic
950496586 3:13337693-13337715 TTCCCACCTGTCCCCACCCAGGG - Intronic
952927164 3:38328727-38328749 CCCTCATCTGTCTGCACACAGGG + Intergenic
953732289 3:45460327-45460349 ACCCCAACTGTCAGCAGACAGGG - Intronic
954139455 3:48597332-48597354 ACCCCATCTGTTTCCAACCAGGG + Intergenic
954655325 3:52190950-52190972 ACCCCTTCTGCCCGGACACAAGG - Intergenic
957026897 3:75192571-75192593 ACCCCACCACTCGCCACACACGG - Intergenic
958709605 3:97701302-97701324 ACCCCTACTATCTCCACACAGGG - Intronic
960938989 3:122921505-122921527 TCTCCATCTGTCCCCACATCTGG + Intronic
961312731 3:126014041-126014063 CCCGCATCTGCCCCCACAGAAGG - Intronic
961415014 3:126750789-126750811 GCCCCATCTGTCACCATAAATGG + Intronic
962041315 3:131710261-131710283 ACCCCATCTTTCCCTTGACATGG - Intronic
962404857 3:135092195-135092217 TCCCCAACTGTCCCCTCCCAAGG - Intronic
963780519 3:149481663-149481685 ATCCCAGCTGTCTCCACACATGG - Intronic
965768365 3:172154883-172154905 ACCCCACTTGTTCCCACGCAGGG - Intronic
967224346 3:187276548-187276570 ACCCCATGTGCACCCACACCTGG + Intronic
968623524 4:1615357-1615379 ACCCCACCTGGGCACACACACGG + Intergenic
969439778 4:7210152-7210174 CACCCACCTGGCCCCACACAAGG - Intronic
970452962 4:16190232-16190254 ACCCCATCTGTCCTCTCACTAGG + Intronic
971258336 4:25033193-25033215 ACCCCAAATATCTCCACACATGG - Intergenic
972711782 4:41604217-41604239 ATCCCATCTGTGCCTACAAATGG - Intronic
974142873 4:57909967-57909989 ACCACATCTGTGGCCAGACACGG + Intergenic
974844859 4:67340053-67340075 AGCCCAGATGTCCCCACAGATGG + Intergenic
977135430 4:93298095-93298117 ACCCCATCTTTGCCCAAATATGG + Intronic
977335359 4:95691531-95691553 AACCCTCCTGCCCCCACACATGG - Intergenic
982065455 4:151650520-151650542 GCCTCATCTCTCCCCACAAATGG - Exonic
988626645 5:32883529-32883551 TGCCCATCTGTCCCAACACCTGG + Intergenic
990488366 5:56280680-56280702 GCCCCATATGTCTCCACACTAGG + Intergenic
993115463 5:83715058-83715080 AATCCATCTGTTCTCACACAGGG + Intronic
993900193 5:93579728-93579750 ACCCCCTCTGTCCCCACCCCTGG + Intergenic
996029757 5:118692214-118692236 ACCCCAACTGTCTCCATGCAAGG + Intergenic
997399227 5:133589607-133589629 AACTCATCTCTCCCCACAGAAGG + Intronic
997476239 5:134144214-134144236 AGCCGTGCTGTCCCCACACAGGG + Intronic
1002097966 5:176843231-176843253 ACAGCATCTGTCCCCTCACCTGG - Intronic
1002195832 5:177500790-177500812 CCCCCATCTCCCTCCACACATGG - Intergenic
1003634515 6:7820480-7820502 ACCCCTTCTGTCCCCACCAAAGG + Intronic
1006298146 6:33179126-33179148 ACCCCATCTCTCCTCTCACCAGG - Exonic
1006704197 6:36003594-36003616 ACACCACCTCTCCCCACAGAAGG + Intronic
1011618637 6:89221303-89221325 ACCCCAGCTGCTCCCAAACAGGG + Intronic
1017363536 6:153604873-153604895 ACCTCAGCTGTACCCCCACAAGG + Intergenic
1019557786 7:1641240-1641262 ACCCCCTTTGGCCCCACAGAGGG + Intergenic
1020448689 7:8297663-8297685 ACCCAAACTATCCGCACACATGG + Intergenic
1021826131 7:24553452-24553474 TCCACATCTGTCCCTACAAAAGG - Intergenic
1024147865 7:46535593-46535615 CCCCCATCTGTCTACGCACATGG + Intergenic
1025952626 7:66157506-66157528 ACCACACCTGGCCCCAGACAAGG - Intergenic
1026849829 7:73717672-73717694 ACCCCCACCCTCCCCACACAAGG - Intronic
1027741105 7:82006585-82006607 ACTCTATCTGTGCCTACACAAGG - Intronic
1027775917 7:82463883-82463905 ACCCCAACTTTCCACACCCAAGG - Intergenic
1027885340 7:83897546-83897568 ACTCCATCTCACCGCACACATGG + Intergenic
1029032297 7:97481383-97481405 ACACACTCTGACCCCACACAGGG - Intergenic
1030650487 7:112111310-112111332 ACCCCCTCCCTCCACACACAAGG - Intronic
1031580415 7:123467756-123467778 ACCTCCTCTGTTCCCAGACAAGG - Intronic
1032383494 7:131506225-131506247 AGCCACTCTGTCCCCACACTTGG + Intronic
1034562980 7:151893679-151893701 TCCCCACCTGTCCCCAAGCAAGG - Intergenic
1034935234 7:155194969-155194991 ATCCAAACTGTCCCCAGACATGG - Intergenic
1034941173 7:155231392-155231414 ACCCCATGGATCACCACACACGG + Intergenic
1034960701 7:155362642-155362664 ACCCCATCACTCCCCAGACTTGG + Intronic
1035678011 8:1468526-1468548 ACCACACCTGTTCCAACACATGG + Intergenic
1036746530 8:11413858-11413880 ACGCCATATGTGGCCACACAGGG + Intronic
1040900608 8:52413928-52413950 TTCCCATCTGTGCCCACCCACGG - Intronic
1042520334 8:69704816-69704838 GCCCCTTCTGACCCCACAGAGGG - Intronic
1046601468 8:116321992-116322014 AGCCCATCTGTTTCAACACAAGG - Intergenic
1048030444 8:130626577-130626599 TCCCCTTCTGTCCCCAAACAAGG + Intergenic
1048274166 8:133053285-133053307 TGCCCATCTGTCCCCACCCCCGG + Intronic
1049213175 8:141395951-141395973 GCCCCATCTGTCCCCAGCCAGGG - Intronic
1049612474 8:143561940-143561962 AGCCCTTCTGTCCCTACAGATGG + Exonic
1052252713 9:26418400-26418422 ACACCATATGTCTCCAAACAGGG - Intergenic
1052461300 9:28767071-28767093 ACCCCACCTTCCCCCACACCTGG - Intergenic
1052669035 9:31532016-31532038 CCCCCACGTGTCCACACACAGGG + Intergenic
1053509905 9:38678868-38678890 ACCCCATCTGGCCCCATAGCAGG + Intergenic
1053567818 9:39271440-39271462 TCCCCATCTGCCGCCACACGTGG - Intronic
1053833827 9:42112387-42112409 TCCCCATCTGCCGCCGCACATGG - Intronic
1054129325 9:61347559-61347581 TCCCCATCTGCCGCCACACGTGG + Intergenic
1057848279 9:98542726-98542748 ACCACATCTTTGCCAACACAGGG + Intronic
1059074175 9:111173585-111173607 ACTCCATCTGTCACTTCACAAGG + Intergenic
1060220347 9:121761146-121761168 AGCCCATTTGTCCCCAAACCGGG - Intronic
1062148907 9:135007439-135007461 CCCCCATCTCTCCCAACACTTGG - Intergenic
1186842238 X:13495561-13495583 AGCCACTCTGTCCCCACACCTGG - Intergenic
1186891553 X:13963955-13963977 ACCCCCTCTCTCCCCACACCAGG + Intergenic
1188440252 X:30209131-30209153 ACCCCTTCAGTCCCCACTTAGGG - Intergenic
1188514957 X:30975395-30975417 ACCCCATCTATCTCCAGAGAGGG + Intergenic
1190362425 X:49661979-49662001 ACCCCAGCTGGGCCCACAGAAGG - Intergenic
1192081122 X:68048887-68048909 CCCCAAGCTGTCCCCAGACATGG - Intronic
1193094139 X:77528139-77528161 ACCCCCTCCTTCCCCGCACAAGG + Intronic
1196234230 X:113260987-113261009 ACCCCATTTGTCACCAGGCAGGG - Intergenic
1200018343 X:153181797-153181819 ACCCCCTCTGTTCTCACGCAGGG - Intronic
1202073184 Y:21013874-21013896 AACCCACCTGTACCCTCACATGG + Intergenic
1202077884 Y:21055728-21055750 AACCCACCTGTACCCTCACATGG + Intergenic