ID: 1181024264

View in Genome Browser
Species Human (GRCh38)
Location 22:20118809-20118831
Sequence CTCTGTGCTCACATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 334}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181024260_1181024264 -4 Left 1181024260 22:20118790-20118812 CCCAAGTTCTGGTGTCTCACTCT 0: 1
1: 0
2: 1
3: 20
4: 203
Right 1181024264 22:20118809-20118831 CTCTGTGCTCACATGGAGCTGGG 0: 1
1: 0
2: 4
3: 35
4: 334
1181024259_1181024264 -3 Left 1181024259 22:20118789-20118811 CCCCAAGTTCTGGTGTCTCACTC 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1181024264 22:20118809-20118831 CTCTGTGCTCACATGGAGCTGGG 0: 1
1: 0
2: 4
3: 35
4: 334
1181024261_1181024264 -5 Left 1181024261 22:20118791-20118813 CCAAGTTCTGGTGTCTCACTCTG 0: 1
1: 0
2: 1
3: 17
4: 257
Right 1181024264 22:20118809-20118831 CTCTGTGCTCACATGGAGCTGGG 0: 1
1: 0
2: 4
3: 35
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181024264 Original CRISPR CTCTGTGCTCACATGGAGCT GGG Intronic
900312031 1:2038222-2038244 CTCTGTGCAGCCATGGAGGTCGG - Intergenic
900808678 1:4784898-4784920 CGCTGTGCTCACCTGGAGTCAGG - Exonic
900813050 1:4822517-4822539 CTTGGTGCTCACTGGGAGCTGGG + Intergenic
900823343 1:4907201-4907223 CTCTGTGCTCACATGGTGGAAGG + Intergenic
902771425 1:18647369-18647391 CTCTGTGACCCCAGGGAGCTGGG + Intronic
904630413 1:31837796-31837818 CTCTTAGCTCACAGGGAGCTGGG - Intergenic
905899639 1:41572951-41572973 TTCTCTACTCCCATGGAGCTAGG + Intronic
906283178 1:44567823-44567845 CTCTGGGTTCACATGGCGCCTGG - Intronic
906880420 1:49583283-49583305 TTCTGTGTCCACATGGAGTTGGG - Intronic
909555988 1:76954799-76954821 CTCTGTGGTCAAATGGAGCTGGG + Intronic
910437938 1:87224752-87224774 CTCTGTGCTCAGAAGGGCCTTGG + Intergenic
911818715 1:102388287-102388309 CTTTCTGCTCACATGGAATTTGG + Intergenic
912386866 1:109275161-109275183 CTCTCTCTTCACAGGGAGCTGGG - Exonic
914077492 1:144369066-144369088 CTGTGTCCTCACATGGAGGAAGG + Intergenic
914101687 1:144597439-144597461 CTGTGTCCTCACATGGAGGAAGG - Intergenic
915002195 1:152603613-152603635 CTCTGTGATTACATGAAGATAGG + Intergenic
918753055 1:188298017-188298039 TTGTGTTCTCACCTGGAGCTTGG + Intergenic
920310331 1:205044548-205044570 CCCTCTGCTCAGAAGGAGCTGGG + Intronic
920607144 1:207399680-207399702 TTGTGTGCTCACATGGAGCGGGG - Intergenic
920724986 1:208426668-208426690 CTGTGTCCTCACATGGAGGAAGG + Intergenic
921576088 1:216836595-216836617 CTCTGTGTGTACAAGGAGCTTGG + Intronic
921598093 1:217076901-217076923 CTCTGTGCTTCCATGGAGAAGGG - Intronic
922473067 1:225888520-225888542 CCATTTGCTCACATGGAACTGGG - Intronic
1063954858 10:11256307-11256329 CTCTGTGCTGAGAAGGGGCTGGG - Intronic
1063993033 10:11586977-11586999 ATCTGTCCTCACAGGGAGGTTGG - Intronic
1064934087 10:20660694-20660716 CTGTGTGCTCACATGGTGGAAGG - Intergenic
1067158557 10:43803145-43803167 CTGTGCCCTCACATGGAGCAAGG + Intergenic
1067190721 10:44065684-44065706 CTCTGTGCTTGCGTGGAGGTTGG + Intergenic
1067449460 10:46372705-46372727 CTCTGTCCTCACATGGTGGAAGG + Intronic
1067587915 10:47488055-47488077 CTCTGTCCTCACATGGTGGAAGG - Intronic
1067635035 10:47996163-47996185 CTCTGTCCTCACATGGTGGAAGG - Intergenic
1068222834 10:54064828-54064850 CTCTGTGCTCTCAGGGATCCAGG - Intronic
1069618351 10:69820609-69820631 CTCTGTGCCCACCTGTACCTTGG + Intronic
1069710263 10:70483451-70483473 CTTTGGGCTCCCAGGGAGCTGGG + Intronic
1069896244 10:71681922-71681944 CTCTGTGCTTACCTGGAGAGAGG + Intronic
1070290293 10:75109329-75109351 TTCTGTGTTCTCATGGAGTTTGG - Intronic
1071610082 10:87023868-87023890 CTCTGTCCTCACATGGTGGAAGG + Intronic
1071911716 10:90242809-90242831 CTCTGCCCTCACATGTGGCTGGG - Intergenic
1072015213 10:91340183-91340205 TTATGTGCTCACATTGTGCTAGG + Intergenic
1072991913 10:100204007-100204029 CTCTGTCCTCACATGCAGAAGGG + Intronic
1073569651 10:104566918-104566940 CTGTGTGCTCACATGAAGAAAGG - Intergenic
1074079703 10:110157790-110157812 CTCTGTCCTCACATGGTGGAAGG + Intergenic
1075996495 10:126880652-126880674 CTCTGTGCTAAAAGAGAGCTCGG - Intergenic
1076095479 10:127732141-127732163 CTGTGTTCTCATCTGGAGCTTGG + Intergenic
1077931533 11:6738019-6738041 CTTTGTGGTCACCTGGAGATTGG - Intergenic
1079277700 11:19057043-19057065 CTATGCCCTCACATTGAGCTAGG - Intronic
1079733040 11:23960132-23960154 CTCTCTGCTCCCATAGTGCTAGG + Intergenic
1081348302 11:42017669-42017691 CTGTGTCCTCACATGGTGGTAGG + Intergenic
1081565214 11:44256553-44256575 CTCTGTGTACACATGTAGATAGG - Intergenic
1081785224 11:45741810-45741832 CTCTGTGGTCACTGGCAGCTTGG - Intergenic
1082114312 11:48311586-48311608 CTGTGTCCTCACATGGTGGTAGG + Intergenic
1082201124 11:49368965-49368987 ATTTGTCCTCACAGGGAGCTGGG + Intergenic
1083148778 11:60777016-60777038 CTCTGACGTCACATGGAACTAGG - Intergenic
1083577897 11:63805624-63805646 CCCTCTCCTCACTTGGAGCTGGG + Intergenic
1084325585 11:68397904-68397926 CACTGTGCTCCCAGGGATCTGGG + Intronic
1084450066 11:69231390-69231412 TTCTGGGTTCACATGGACCTGGG + Intergenic
1085064537 11:73481951-73481973 CTGTGTCCTCACATGGCTCTAGG - Intronic
1089003819 11:115074308-115074330 CTCTGTTTTCACTTGGAGTTAGG - Intergenic
1089868361 11:121651468-121651490 CTCTGTCCTCACATGGAGAAAGG + Intergenic
1090471442 11:126984759-126984781 CTGCGGGCTCACATGGAGCTTGG - Intronic
1091958260 12:4667108-4667130 CTGTGTGCTCACATGGTGGAAGG + Intronic
1093514830 12:19973419-19973441 CTCTGTTCTCCCAAGGACCTAGG + Intergenic
1094485408 12:30922742-30922764 CCCTGTGCTGGCATGGAGCAGGG + Intergenic
1096038179 12:48491283-48491305 CTGTGTCCTCACATGGAGGAAGG + Intronic
1096297393 12:50395202-50395224 CTCTGGCCTCCCAAGGAGCTGGG + Intronic
1098693071 12:73514601-73514623 CTTTGTGCTCACTTAGATCTGGG - Intergenic
1099441716 12:82707226-82707248 CTGTGTCCTTACATGGAGGTCGG + Intronic
1100181116 12:92087711-92087733 CTCTGAGCTCCCTTGGGGCTAGG - Intronic
1100749620 12:97682848-97682870 TTCAGAGCTCACATGGGGCTAGG + Intergenic
1100800896 12:98229197-98229219 CACTGTGCTCACTGGGTGCTTGG - Intergenic
1101467558 12:104963079-104963101 CTCTGTGCCCACCTTGGGCTGGG - Intergenic
1101671970 12:106883950-106883972 CTCTGTGCTCTCATGAAGCCGGG - Intronic
1101695204 12:107119095-107119117 CTCTGTTCACATATGGAGGTGGG - Intergenic
1101860917 12:108481774-108481796 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1102435637 12:112921092-112921114 ATCTGTGCTCAGGTTGAGCTGGG - Intronic
1103344884 12:120242552-120242574 CTCTGTGGTCAGCTGGGGCTGGG - Intronic
1104047156 12:125171559-125171581 CTGTGTCCTCATCTGGAGCTTGG + Intergenic
1104052133 12:125202476-125202498 TGCTGTGCTCACATGGTGGTTGG + Intronic
1104105802 12:125657817-125657839 CTCTGTGGTCACATGAAGGGAGG + Exonic
1104169853 12:126269541-126269563 CTCTGTGCTCCCTTGGAGCTTGG - Intergenic
1104354487 12:128073363-128073385 CTCTGTGATCTCTTGGATCTGGG - Intergenic
1104506555 12:129337664-129337686 CTTTGGGCTCACATAGATCTTGG + Exonic
1104678507 12:130732114-130732136 CTCTGTGCCCCCATGGCTCTTGG - Intergenic
1104869305 12:131983215-131983237 TTTTGCACTCACATGGAGCTAGG - Intronic
1105847119 13:24302782-24302804 GGCTGTGCTTCCATGGAGCTGGG + Exonic
1105889629 13:24673259-24673281 CTCTGTGAACACATCGATCTTGG - Intergenic
1106690068 13:32105277-32105299 CTGTGTCCTCACATGGAGAAAGG - Intronic
1107634102 13:42374598-42374620 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1107863308 13:44681645-44681667 GTCTGTGCCCACGTGGAGCCAGG + Intergenic
1108938410 13:55916009-55916031 CTCTTTTCTCACCAGGAGCTTGG - Intergenic
1109435675 13:62297401-62297423 GTCTGTGCTCTCATGTAGGTGGG - Intergenic
1112462982 13:99619279-99619301 CTGTGTCCTCACATGGCGCAGGG - Intronic
1112719766 13:102230149-102230171 CTGTGTTCTCACATGGTGCAAGG - Intronic
1113307932 13:109098169-109098191 CTGTGTTCTCACATGGTGTTAGG + Intronic
1113501539 13:110779355-110779377 CTGTGTGCTCACATGGTGGAAGG + Intergenic
1114075636 14:19159765-19159787 CTATGTGTTCACCTGGAGCCTGG + Intergenic
1114086525 14:19239807-19239829 CTATGTGTTCACCTGGAGCCTGG - Intergenic
1115304292 14:31917957-31917979 CACTATGCTGACATGGATCTCGG - Intergenic
1115443997 14:33468351-33468373 TTCTGTTAACACATGGAGCTTGG - Intronic
1115705035 14:35989946-35989968 CTGAGTGATCACATGGAGCATGG + Intergenic
1115825121 14:37262746-37262768 CTCTGAGCTCCCAGGTAGCTGGG + Intronic
1118041415 14:61921045-61921067 CTCTGTGCTCACTTCCAGCTTGG + Intergenic
1118408728 14:65453671-65453693 CTCTGGGCTGACACTGAGCTTGG - Intronic
1118757212 14:68853792-68853814 CTCTGTGCTTACATGTCGCCTGG + Intergenic
1118801096 14:69190704-69190726 CTTTGTGCTCACCTGTTGCTAGG - Intergenic
1119502276 14:75140033-75140055 CTGTGTTCTCACATGGAGGAAGG - Intronic
1119811427 14:77523620-77523642 TCCTGCACTCACATGGAGCTGGG + Intronic
1120431204 14:84418568-84418590 CTCTGTGCTTCCCTGGAGCAGGG - Intergenic
1121526515 14:94623015-94623037 CTCTGTGCTCACACAGCACTGGG + Intronic
1121881440 14:97503871-97503893 CTCTGTCCTCACATGGTGAAAGG - Intergenic
1122027165 14:98886453-98886475 CTCTCTGCCCTCCTGGAGCTTGG + Intergenic
1122745597 14:103895561-103895583 CCCTGTGCTCACAGGGAACGAGG + Intergenic
1122810674 14:104286267-104286289 CTGTGTCCTCACATGGAGGACGG + Intergenic
1202898022 14_GL000194v1_random:21225-21247 CTGAGTGCTCTCATGGAGCCTGG - Intergenic
1123955649 15:25331594-25331616 GTCTCTGCCCTCATGGAGCTTGG + Intergenic
1123980232 15:25595451-25595473 CACTGTACTCACATAAAGCTAGG - Intergenic
1124347667 15:28933333-28933355 CTCTGTCCTCACATGGTGGAGGG - Intronic
1124880978 15:33642326-33642348 CTCTGTGCTCACATCAAGGCTGG + Intronic
1125495013 15:40185160-40185182 CTCTGTTCTGGCTTGGAGCTAGG - Exonic
1127825803 15:62701856-62701878 CACTGTGCTCATGTGAAGCTTGG + Intronic
1128860739 15:71069599-71069621 CTGTGTCCTCACATCGTGCTGGG + Intergenic
1129977136 15:79831791-79831813 CCATGTGCTCACATGGAGCTGGG - Intergenic
1130112860 15:80980452-80980474 CTATGTTCACACATAGAGCTTGG - Intronic
1130114610 15:80995996-80996018 CTCTCTGTTCACCTGCAGCTGGG - Intergenic
1130233287 15:82112962-82112984 CTCTGTGCTCACCTGGTGAGTGG - Intergenic
1132019328 15:98346733-98346755 CACTGTGCTCACATGGTGGAAGG + Intergenic
1132025257 15:98399648-98399670 CTGTGTGCTCACATGGAGGAAGG - Intergenic
1132125720 15:99222646-99222668 CTCTGAGATCACCTGGAGCTGGG - Intronic
1132183948 15:99787294-99787316 CTCTGTACTCACGTAGAACTCGG + Intergenic
1132295935 15:100734503-100734525 ATCTGTGCCCATGTGGAGCTAGG - Intergenic
1132434433 15:101785848-101785870 CTCTGTACTCACCTAGAACTTGG - Intergenic
1132756393 16:1487451-1487473 CCCTGTGCTCAGAGGCAGCTCGG + Exonic
1133544033 16:6787717-6787739 CTCTGTGCTCATTTGCAGCTTGG - Intronic
1134102504 16:11461966-11461988 CTGGGGGCTCACATGGAGCTTGG + Intronic
1134254486 16:12600383-12600405 CCCTGTGCTCTCAGGGGGCTGGG + Intergenic
1135290947 16:21237559-21237581 CTGTGTCCTCACATGGAGGAAGG + Intronic
1135915501 16:26602126-26602148 ATCTCTGCTCTCATGGAGCTGGG + Intergenic
1137461684 16:48670314-48670336 CTTTGTGCACAGATGGATCTAGG - Intergenic
1137822626 16:51460414-51460436 CTCTGGGCTCACAGGCAGCTTGG + Intergenic
1138277131 16:55743234-55743256 CTCTGTGGACAACTGGAGCTGGG + Intergenic
1138283021 16:55786413-55786435 CTCTGTGGACAACTGGAGCTGGG + Intergenic
1138506035 16:57478737-57478759 CTCTGTGCTTGCTTGGTGCTTGG - Intronic
1138973260 16:62171441-62171463 CTGTGTCCTCACATGGGGCAAGG + Intergenic
1139476862 16:67207199-67207221 CTCAGTGCACACAGGGTGCTGGG + Exonic
1139511922 16:67432467-67432489 CTGTGTGATCAGATGGGGCTGGG + Intronic
1140444842 16:75017713-75017735 CTCTCTGCTCCCAAGGTGCTTGG + Intronic
1141482803 16:84318174-84318196 CTCTGTGCTGTCATGAAGTTGGG + Intronic
1145829827 17:27906984-27907006 CTCTATGCTCTCCTGGGGCTGGG - Intergenic
1145903019 17:28500142-28500164 CTCTGAGTTCACCTGGACCTGGG + Intronic
1146297139 17:31659114-31659136 CTGTGTGCTCACATGGAATGGGG + Intergenic
1149565259 17:57636577-57636599 CTCTGTGCTCTCACTGAACTAGG - Intronic
1150144343 17:62755249-62755271 CTCTGCTGTCACCTGGAGCTTGG - Intronic
1150600669 17:66648144-66648166 CTGTGTCCTCACATGGTGCAAGG + Intronic
1151464653 17:74276674-74276696 CTCTGTTCTCACTCGGGGCTTGG + Intronic
1151591720 17:75048673-75048695 CTCTGTGCCCAGAGGAAGCTCGG - Intronic
1152346377 17:79754855-79754877 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1152845713 17:82598567-82598589 CTGTGTGCTCACGTGGTGATGGG + Intronic
1152966695 18:122640-122662 CACTCTGCCCACATGGGGCTTGG + Intergenic
1153706214 18:7748374-7748396 CTCCCTCCTCACAAGGAGCTTGG - Intronic
1153931364 18:9882497-9882519 CTCTGGGCTCAGAGGGAGTTGGG + Intergenic
1157116825 18:44869952-44869974 TTGTGTGCTCACATAGAGCCTGG + Intronic
1157663579 18:49466781-49466803 CTATGTCCTCACATGGAGGAAGG - Intergenic
1158703171 18:59767304-59767326 CTCTGTCCTCACATGGTGGAAGG - Intergenic
1159336243 18:67071206-67071228 CTCTGTGTACACATGCAGTTAGG + Intergenic
1159473836 18:68891717-68891739 CTCTGTGCTCACTTGGAGAGAGG + Intronic
1160489736 18:79326586-79326608 CCCTGAGCTCACATGGTGTTCGG + Intronic
1160805489 19:990663-990685 GCCTGTGCTGAAATGGAGCTTGG - Intronic
1163335297 19:16667389-16667411 CTCTTTCCTCACATGGAGCTTGG - Intronic
1163683916 19:18699938-18699960 CTCTGTGATGACCTGGGGCTTGG + Intronic
1163685319 19:18709043-18709065 CTCTGAGCCCGCATGGTGCTCGG + Intronic
1163711103 19:18847357-18847379 CACTGTGCTCCCAGGGAGCTGGG - Intronic
1164596303 19:29532675-29532697 CTCTGACCTCAGAGGGAGCTTGG + Intronic
1164730554 19:30500929-30500951 CTCTGAGCTGACAGGGAGCCTGG - Intronic
1164804096 19:31102800-31102822 CCCAGAGCTCACATGGAGCAAGG + Intergenic
1165379699 19:35469905-35469927 CTCTGTGCTCACATGTATGAAGG - Intergenic
1165578626 19:36843212-36843234 CTCTTTTCTCACAGGGATCTTGG - Intronic
1165633004 19:37317520-37317542 CTCTGTGTTCACCGGGAGGTGGG + Intronic
1166119499 19:40677197-40677219 CTCTGTGCTCTGCTGGCGCTTGG + Intronic
1166869874 19:45864574-45864596 GTGTGGGCTCACATGGAGCAGGG + Intronic
1167068758 19:47206927-47206949 GTCTCTGTCCACATGGAGCTTGG - Intronic
1167707965 19:51093098-51093120 CTGTGTGCTCTCCTGGGGCTGGG - Intergenic
1167800147 19:51735382-51735404 CTGTGTCCTCACATGGTGGTGGG + Intergenic
924996812 2:368819-368841 CTGTGTCCTCACATGGAGGGAGG + Intergenic
925022135 2:579570-579592 ACCTGTGCTCACAAGGAGCTTGG + Intergenic
925920687 2:8635962-8635984 CCCTGTGCTCTTGTGGAGCTGGG - Intergenic
925929191 2:8693899-8693921 CACGGTGCTCTCATGGAGCCTGG - Intergenic
926324741 2:11774742-11774764 GTGTGTGCTGACATGGAGGTTGG + Intronic
927200108 2:20572878-20572900 CCCTCTGCTCCCATGGGGCTTGG - Intronic
928169026 2:28991640-28991662 CACTCTGCTCCCAAGGAGCTGGG - Intronic
930869476 2:56155409-56155431 CTCTGTGCCCACGTGGAGGCTGG + Intergenic
930912846 2:56650784-56650806 CTCTGTTCTCACATGGTGGAAGG - Intergenic
932500322 2:72177599-72177621 CTATGAGCTCACATGTAGCCTGG + Exonic
933535068 2:83561773-83561795 CTCTGTGACCACATGGAGACTGG + Intergenic
934976311 2:98805352-98805374 CTCTATGTGCACAGGGAGCTAGG - Intronic
935039841 2:99415580-99415602 CTCAGTGGTCACATGGAGCAAGG - Intronic
935180621 2:100687371-100687393 CTGTGTCCTCACATGGAGGAAGG - Intergenic
936022099 2:109002600-109002622 CTCTAACCTCACATGGACCTAGG + Intergenic
937571413 2:123367474-123367496 CTTTGTGTTCACATTGATCTAGG - Intergenic
937674850 2:124578654-124578676 CTCAGTCCCCACAAGGAGCTGGG - Intronic
938140237 2:128789466-128789488 CTTTGGACTCACGTGGAGCTGGG - Intergenic
938240558 2:129739444-129739466 CCCTGTGCCCACATAGGGCTAGG + Intergenic
939699351 2:145371111-145371133 CTCTGTGCTCCCATAGACCCAGG - Intergenic
939801778 2:146720294-146720316 CCCTGTGCTCTCAGGGACCTGGG + Intergenic
940303926 2:152205458-152205480 CTTTGTCCTCCCATGTAGCTGGG + Intergenic
942266829 2:174235862-174235884 CTCAGGGCTCACATGGAGATTGG + Intronic
943916611 2:193643575-193643597 AGCTGTGCTCAGATGGAGCCAGG + Intergenic
945002981 2:205371485-205371507 CACTGTGCTGACATGGAACTAGG + Intronic
946131064 2:217607260-217607282 CTCTGTGAGAACATGCAGCTAGG - Intronic
947497982 2:230652588-230652610 CTATGTGCTCAGATGGGGCCTGG - Intergenic
948601987 2:239112518-239112540 CTCTCTGATGAGATGGAGCTGGG + Intronic
1168770104 20:408979-409001 CTCTGTGCTGAGATGGGGCTAGG + Intronic
1169348242 20:4846939-4846961 CCCATTGCTCACATGGAGCAAGG + Intergenic
1169615338 20:7437289-7437311 ATCTGTGCACACCTGCAGCTGGG - Intergenic
1169877159 20:10310732-10310754 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1170830648 20:19837240-19837262 TTCTGGGCTCACACTGAGCTGGG - Intergenic
1171134768 20:22686398-22686420 CTCTGTGCTCCCATTGTGCCTGG + Intergenic
1171277201 20:23867476-23867498 CTGGGTGCTCACATGGTGCTGGG - Intergenic
1171349335 20:24490802-24490824 CTCTGTGCTGCCCTGGAGCCTGG - Intronic
1171442760 20:25178723-25178745 CTCCCTTCTCTCATGGAGCTGGG - Intergenic
1171528485 20:25834969-25834991 CTCGGTGCTCACCGGGAGCCGGG + Intronic
1171548341 20:26020917-26020939 CTCGGTGCTCACCGGGAGCCGGG - Intergenic
1172598917 20:36169996-36170018 GTCTGTGCTCACCTGGGCCTGGG + Intronic
1172603865 20:36201553-36201575 CTCTGAACTCCCCTGGAGCTTGG + Intronic
1173264283 20:41464675-41464697 CCCTCTGTGCACATGGAGCTAGG - Intronic
1174041286 20:47701596-47701618 CTCTATGCTCACCAGGAGCTAGG + Intronic
1175509703 20:59515524-59515546 CTCTGTGCACACCTGGTGCCTGG + Intergenic
1175869523 20:62201742-62201764 CTCTGTGCTCAGTGGGAGCCAGG + Exonic
1178626794 21:34225170-34225192 CACTGTGCCCACCTGCAGCTAGG + Intergenic
1178908304 21:36654081-36654103 CTGTGTGCCCACATGGACCCAGG - Intergenic
1179451642 21:41472426-41472448 CTCTGGGCCCACTAGGAGCTGGG - Intronic
1180291338 22:10852931-10852953 CTATGTGTTCACCTGGAGCCTGG + Intergenic
1180494143 22:15882353-15882375 CTATGTGTTCACCTGGAGCCTGG + Intergenic
1181024264 22:20118809-20118831 CTCTGTGCTCACATGGAGCTGGG + Intronic
1182446478 22:30392625-30392647 CTCTGTGCTCACAGCTATCTGGG + Intronic
1182484307 22:30630120-30630142 CTCTGGGCTCCCATGGAGGATGG + Intergenic
1182555468 22:31126379-31126401 CACTGTGGTCACATGGAACGTGG + Exonic
1183395078 22:37566885-37566907 CTTGGAGCTCACTTGGAGCTTGG - Intronic
1183420429 22:37708792-37708814 CTCTGGCCTCAGATGGACCTCGG - Intronic
1183529922 22:38347794-38347816 CTCTGTGCTCCGAGGCAGCTGGG - Intronic
1184461289 22:44639629-44639651 CTCTGTGCTTCGATAGAGCTGGG + Intergenic
1185019731 22:48367140-48367162 CACTGTCCTCACATGGAGGAAGG + Intergenic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
951389075 3:22080835-22080857 CTGTGTCCTCACGTGGAGCAAGG - Intronic
953250823 3:41244654-41244676 CTCTGAACTCAAATGGACCTGGG + Intronic
953490773 3:43348226-43348248 CTTGGTGCTCCCATGAAGCTGGG - Exonic
954223571 3:49168881-49168903 CTCTCTGCTCAGATAGAGCTGGG - Intergenic
956193056 3:66625381-66625403 CTCTGTGCTGGCACTGAGCTAGG - Intergenic
956774540 3:72554039-72554061 CTATGTCCTCACATGGCGCAAGG + Intergenic
956894522 3:73646192-73646214 CCCTGTGCCCTCATGGAGTTTGG - Intergenic
959475607 3:106808202-106808224 CTCTGAGCTTACATAGATCTGGG - Intergenic
963271791 3:143292179-143292201 CTGGGTGCTGACATGGTGCTTGG + Intronic
964832748 3:160903714-160903736 GTGTGTGCACACATGGAGGTGGG + Intronic
964985804 3:162736516-162736538 CTGTGTTCTCATCTGGAGCTTGG - Intergenic
966256008 3:177917517-177917539 CTCTGTGCTCTTGTGGGGCTGGG + Intergenic
967810197 3:193753284-193753306 CTCAGGGCTCACATAGAGTTAGG - Intergenic
968742951 4:2340551-2340573 CTCTGTGCCCACCTGCAGCTTGG - Intronic
969180316 4:5435736-5435758 CTCTCTGCCCTCAAGGAGCTTGG + Intronic
970550673 4:17177960-17177982 CTGTGTCCTCACATGGAGGAAGG + Intergenic
974610598 4:64210401-64210423 CTGTGTGCTCACATGGTGGAAGG - Intergenic
977127361 4:93186999-93187021 CTGTGTCCTCACATGGTGCAAGG + Intronic
978494967 4:109348807-109348829 CTTTGTGCTCACATGGTGGAAGG - Intergenic
978631861 4:110756863-110756885 GTCTGTGTTCTCATGGAGCTGGG - Intergenic
980614588 4:135202332-135202354 CTGTGTCCTCACATGGAGGAAGG - Intergenic
981817074 4:148842923-148842945 CTCTTTGCTCACAAGAAGTTGGG + Intergenic
983860707 4:172702662-172702684 CACTGTCCTCACATGGAGGGAGG - Intronic
983862672 4:172727180-172727202 CTATGGGCACACAAGGAGCTTGG - Intronic
984386898 4:179072328-179072350 CTCTGTTCTCACATGGACGAAGG + Intergenic
984745881 4:183216929-183216951 CTCAGAGCTCACATAGGGCTGGG + Intronic
984808473 4:183772923-183772945 CTCTGTCCTCACATGGTGGAAGG + Intergenic
986323357 5:6652091-6652113 CTTTGTTCTCACAGGAAGCTTGG - Intronic
989734761 5:44690501-44690523 CTGTGTCCTCACATGGAGGAAGG + Intergenic
990703500 5:58500734-58500756 TTGTGTCCTCACATGGTGCTGGG - Intergenic
993342240 5:86738905-86738927 CTCAGTGCTCACAAGGGTCTAGG + Intergenic
994114809 5:96050231-96050253 CTCTGTTCTTTCAGGGAGCTTGG + Intergenic
994163271 5:96580940-96580962 TTGTGTCCTCACATGGAGCAAGG - Intronic
994309965 5:98258671-98258693 CTCTGTGCTGATCTGGAGCTGGG + Intergenic
994999310 5:107106805-107106827 CTATGTCCTCACATGGAGGAAGG - Intergenic
995311890 5:110722555-110722577 CTGTGTGCTCTCATGGAGGCTGG + Intronic
996832920 5:127759430-127759452 CTCTGTCCTCACATGGTGGAAGG - Intergenic
997386164 5:133474434-133474456 CTCAGTGCACTGATGGAGCTAGG - Intronic
997849258 5:137316160-137316182 CTGTGTGCTCACATGGTGGAAGG + Intronic
998015152 5:138725764-138725786 CTCTCTGGCCACATGGAGCTGGG + Intronic
1000284083 5:159811528-159811550 CTGTGTGCTCACATGGTGGAAGG - Intergenic
1001879912 5:175234380-175234402 CTGTGTGTTCTCAGGGAGCTAGG - Intergenic
1002053204 5:176583690-176583712 CTCTGTGCTCAGTCAGAGCTGGG - Intronic
1002914566 6:1518667-1518689 TTCTGTAGTCACCTGGAGCTGGG + Intergenic
1002951852 6:1821312-1821334 CTCTCCGCTCAAAAGGAGCTGGG - Intronic
1003540822 6:7016632-7016654 TGATGTGCTCACATGGAGCCTGG - Intergenic
1004314656 6:14575345-14575367 CTCTGTGGTCTCATGATGCTGGG - Intergenic
1005214523 6:23509612-23509634 CCCTGTCCTCACATGGAGGAAGG - Intergenic
1005353525 6:24960341-24960363 CTGTGTCCTCACATGGAGAAGGG + Intronic
1007418367 6:41705281-41705303 CTCATTGTTCAGATGGAGCTGGG - Intronic
1007524360 6:42478909-42478931 CTCTGTGCTCACATGGACAAAGG - Intergenic
1007692181 6:43709710-43709732 CTCTGGACTCACATAGACCTGGG - Intergenic
1008142055 6:47843407-47843429 CTGTGTCCTCACATGGTGCAAGG + Intergenic
1008964452 6:57300256-57300278 CTCTGTCCTCACAAGCACCTGGG + Intergenic
1012164480 6:95931131-95931153 TACAGTTCTCACATGGAGCTTGG + Intergenic
1013043348 6:106458809-106458831 CTCTGTGTTCACCTGCATCTTGG - Intergenic
1013362226 6:109404608-109404630 GTAGGTGCTCACATGGTGCTAGG - Intronic
1013642644 6:112101865-112101887 CTCAGAGCTCACACTGAGCTGGG + Exonic
1016677267 6:146785731-146785753 CTCTGTGCTCTGAGGCAGCTGGG - Intronic
1019160203 6:170064303-170064325 CGCTGTCTTCACCTGGAGCTTGG - Intergenic
1019340436 7:506524-506546 GTGTGTGCTCACCTGGTGCTTGG - Intronic
1019891057 7:3946813-3946835 CTCTGTGTTTAAAGGGAGCTGGG + Intronic
1019981633 7:4625800-4625822 CTCTGTTCTCCCATGGTGCTTGG - Intergenic
1020078581 7:5274576-5274598 CTCTGTGCTCCCTTGGAGCCCGG + Intronic
1020628814 7:10615668-10615690 CTCTGTGATCACAGTCAGCTGGG - Intergenic
1021468219 7:20969866-20969888 CTTTGTTCTCACATGGAGGAAGG - Intergenic
1022407195 7:30101482-30101504 CTGTGTCCTCACATGGAGGAAGG + Intronic
1023530466 7:41148509-41148531 CTCTGTGCTCACAAGTTGTTTGG + Intergenic
1025200309 7:56957608-56957630 CTCTGTGCTCCCTTGGAGCCCGG - Intergenic
1025671636 7:63619324-63619346 CTCTGTGCTCCCTTGGAGCCCGG + Intergenic
1026653457 7:72235883-72235905 TTCTGTGCTACCTTGGAGCTTGG - Intronic
1026898858 7:74026390-74026412 CTCTGTGTTCAGCTGGTGCTAGG - Intergenic
1028906519 7:96160560-96160582 CTGTGTCCTCACATGGAGGAAGG + Intronic
1029666146 7:101996477-101996499 CTCCATGGTCACATGGGGCTTGG - Intronic
1029972459 7:104802549-104802571 CTCTGTCCTCACATGGTGGAAGG - Intronic
1030096510 7:105905394-105905416 CTGTGTGTGCACATGGAGCCTGG - Intronic
1030099883 7:105936430-105936452 CTCTGTGCTCACATGGTGGAAGG - Intronic
1030620566 7:111785767-111785789 CCATGTGCCCACATTGAGCTAGG + Intronic
1035403988 7:158586992-158587014 CTCTGTCCTCACTGGGGGCTCGG - Intronic
1035762419 8:2079013-2079035 CTCAGGGCTCACATCGAGTTGGG - Intronic
1036498693 8:9294154-9294176 CTCTGGCCTCACCTGGAACTGGG + Intergenic
1036645690 8:10610560-10610582 CTGGGAGCTCACATGGAGCCAGG - Exonic
1036746366 8:11412822-11412844 CTCTGGGCTCACATGGACAATGG + Intronic
1037581126 8:20246638-20246660 CACTGAGCTCACATGGGACTGGG - Exonic
1037808325 8:22070498-22070520 CTCTGTGTTCCCATAGCGCTTGG + Intronic
1038389032 8:27177855-27177877 ATCTGTGGTCACCTAGAGCTGGG + Intergenic
1039795366 8:40908482-40908504 CTGTGTCCTCACATGGAGGGAGG + Intergenic
1040889736 8:52304819-52304841 CTGTGTTCTCACATGGAGGAAGG + Intronic
1042678375 8:71349042-71349064 CTCTGAGATCAAATGGAGATGGG - Intronic
1042760878 8:72270213-72270235 CCCCCTGCTCACATGGACCTGGG + Intergenic
1044192991 8:89342127-89342149 CTCTGGACCCACTTGGAGCTTGG - Intergenic
1044274822 8:90286675-90286697 CTCTGTGCACACATAGAAATTGG - Intergenic
1045571475 8:103372210-103372232 CTCGCTGATCACATGGACCTGGG + Intronic
1047163459 8:122408551-122408573 ATCTATGCTTACATGGAGCAGGG - Intergenic
1048293910 8:133200408-133200430 CTCTTTGCTGTCATTGAGCTCGG - Intronic
1049030756 8:140035801-140035823 CTGTGGGCTCACGTGGAGCAAGG - Intronic
1049327667 8:142032009-142032031 CTGTGTGCTCACGTGGAGCGGGG + Intergenic
1049401868 8:142431556-142431578 TTCTGTCCTCAACTGGAGCTAGG - Intergenic
1050005805 9:1128995-1129017 CTCTCTCCTCACATGGAGGAAGG - Intergenic
1050797543 9:9562896-9562918 ATGTCTGCCCACATGGAGCTTGG - Intronic
1051782984 9:20710805-20710827 CCCTGTGCTCCCAGGCAGCTAGG - Intronic
1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG + Intergenic
1055130352 9:72767714-72767736 TTCTGTGCTCACTGGGAACTTGG + Intronic
1055631948 9:78233703-78233725 CTCTGTGCTAACACTGTGCTAGG + Intergenic
1057515806 9:95719412-95719434 GTCCTTGCTGACATGGAGCTGGG + Intergenic
1058099170 9:100899580-100899602 CTCTGTGCTCTCATGGTACCTGG + Intergenic
1058572603 9:106363788-106363810 CTGTGTTCTCACATGGAACAAGG + Intergenic
1058596824 9:106623822-106623844 TATTGTGCTCACATGGAGATTGG - Intergenic
1058636301 9:107041688-107041710 CTGTGTCCTCACATGGTGGTGGG + Intergenic
1059284027 9:113157497-113157519 CTCTATTCTCATATGGAGCATGG + Intronic
1061272709 9:129552564-129552586 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1061431531 9:130534351-130534373 CTCTCTGCCCACCTGGGGCTCGG + Intergenic
1061806737 9:133141138-133141160 CCCGGTGCTCTCATGGAGCCAGG - Intronic
1062276588 9:135734209-135734231 CTTTCTGCTCCCATGGAGCCTGG - Intronic
1062287891 9:135781258-135781280 CTCTGGGCTGACATGGTGCTGGG + Intronic
1062520267 9:136954690-136954712 ATCCCTGCTCACAAGGAGCTTGG + Intronic
1185938513 X:4286008-4286030 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1186952552 X:14643202-14643224 CTGTGTTTTCACCTGGAGCTTGG - Intronic
1187974574 X:24692423-24692445 CTCTGTTCTCACATGGAAGAAGG + Intergenic
1188499479 X:30809874-30809896 TTTTTTGCTGACATGGAGCTGGG - Intergenic
1190254991 X:48755535-48755557 GTCCCTGCCCACATGGAGCTGGG - Intergenic
1190984792 X:55490391-55490413 CTCAGTGTTCACATTGGGCTAGG - Intergenic
1191672438 X:63760738-63760760 CTTTGGGCCCACATGGTGCTAGG + Intronic
1192119178 X:68438811-68438833 CTCTGTCCTCACATGGTGGAAGG - Intergenic
1192538146 X:71946147-71946169 CTCTGTCCTCCCATGGCACTAGG - Intergenic
1193012908 X:76697476-76697498 CTCTGAACCCACCTGGAGCTTGG + Intergenic
1193103388 X:77640944-77640966 CCCAGTGATCACATGGTGCTGGG + Intronic
1193370698 X:80694075-80694097 CTCTGCGCACACTTGGAACTTGG + Intronic
1194899448 X:99490847-99490869 CTTTGTGATCACAGAGAGCTTGG - Intergenic
1196143682 X:112293810-112293832 CTCTGTGCTAAAATGTAACTTGG + Intergenic
1198028857 X:132735655-132735677 CTGGATGCCCACATGGAGCTGGG + Intronic
1201151091 Y:11096052-11096074 CTGAGTGCTCTCATGGAGCCTGG - Intergenic