ID: 1181026264

View in Genome Browser
Species Human (GRCh38)
Location 22:20129525-20129547
Sequence GCCCCACGGGACCACAGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181026264 Original CRISPR GCCCCACGGGACCACAGGGT AGG Intronic
900295515 1:1947184-1947206 GCCCCAAGGGGCCACACGGATGG - Intronic
900370810 1:2331351-2331373 GCCCCACGTGGCCACAGGGGTGG + Intronic
900463719 1:2813556-2813578 GCCCCACGGGAGCCCACAGTGGG - Intergenic
901857480 1:12053592-12053614 GCCCCAAGGAAACACAAGGTGGG + Intergenic
903063153 1:20684194-20684216 GCCCCAAGGGCCCACAGGCCAGG - Intronic
903919334 1:26788199-26788221 GCCCCACCAGGCCACAGGGCCGG - Exonic
904592122 1:31620818-31620840 GCCCCACGGGGACACAACGTCGG - Intronic
906145073 1:43555486-43555508 GCACCACGGGACTCCAGGCTGGG - Intronic
907330689 1:53669331-53669353 GGCTCATGGGCCCACAGGGTGGG - Intronic
911178658 1:94842380-94842402 GCCCCAAGGGGCTACAAGGTGGG + Intronic
912439234 1:109686202-109686224 TCCCCACAGGACCACAGGCAGGG - Intronic
913307188 1:117442113-117442135 GGTACACGGGAGCACAGGGTAGG - Intronic
916120499 1:161524665-161524687 GCCCCACGGGAGCTCGCGGTGGG + Exonic
916130263 1:161606297-161606319 GCCCCACGGGAGCTCGCGGTGGG + Intronic
922238346 1:223737920-223737942 CCCCCAGGGGAGCACAGGGAAGG + Intronic
1063495981 10:6508733-6508755 GCACCAGGTGACCACAAGGTTGG + Intronic
1063929761 10:11017773-11017795 GCCCCGCGGGGACACAGGGCGGG - Intronic
1065100354 10:22325528-22325550 GCCCCACGAGGCCACAGCGCTGG - Intronic
1067258786 10:44667628-44667650 GCCCCATGGTCCCACAGGCTTGG - Intergenic
1069623515 10:69852661-69852683 GCCCCACGGAACCCCTGGTTGGG + Intronic
1070935670 10:80293015-80293037 GCACCACGGGGCCGCAGGGGTGG + Intergenic
1072268009 10:93748995-93749017 GACCCAGGGGAAGACAGGGTAGG - Intergenic
1074689586 10:115992185-115992207 GCCTCACAGTTCCACAGGGTTGG - Intergenic
1076364706 10:129914452-129914474 GCCACTCGGAACCGCAGGGTGGG + Intronic
1076743045 10:132497555-132497577 GCCCCAAGGGGCCCCAGGGGTGG + Intergenic
1076837227 10:133027224-133027246 GCCCCCCAGGCTCACAGGGTCGG - Intergenic
1077271152 11:1682130-1682152 GCCCCAGGGAAACACAGGCTGGG + Intergenic
1077300900 11:1846484-1846506 GCCTCACTGGACCACCAGGTAGG + Intergenic
1077500751 11:2908903-2908925 ATCCCAGGGGACCAAAGGGTGGG - Intronic
1083372344 11:62192375-62192397 GTCACCTGGGACCACAGGGTGGG + Intronic
1083685343 11:64371839-64371861 GCCTCAGGGGAGAACAGGGTAGG - Exonic
1083732115 11:64658043-64658065 GTCCCAAGGGCCCACAGGATAGG + Intronic
1084676721 11:70639755-70639777 GCCCTGCAGGCCCACAGGGTGGG + Intronic
1085084792 11:73659801-73659823 GCTCCACATGACCATAGGGTTGG - Intronic
1085524194 11:77154841-77154863 GCCCCACCTGGCCCCAGGGTGGG + Intronic
1089149147 11:116351338-116351360 GCCCCCAGGGACCACAAGGATGG + Intergenic
1090874628 11:130777982-130778004 TCCTCACTGGACCACAGAGTTGG - Intergenic
1091704375 12:2683912-2683934 GCCCCACGGGGGCCCAGGGCGGG + Intronic
1092155344 12:6278650-6278672 GCCTCCCGGGAACACAGGGCAGG - Intergenic
1096789213 12:54034658-54034680 GCCCCGCGGGAACCCTGGGTCGG - Exonic
1101658971 12:106749285-106749307 GGCCCACTGCACCACATGGTAGG - Intronic
1103907184 12:124333740-124333762 GCCCCACGGTTCACCAGGGTGGG + Intronic
1112533130 13:100224125-100224147 GCCCCACAGGAGCCCAGGGAGGG + Intronic
1117338563 14:54775198-54775220 CCCCCAGGTGACCCCAGGGTGGG + Intronic
1120461247 14:84799091-84799113 GCCCCATGGGACCAGAGAATTGG + Intergenic
1122920553 14:104878200-104878222 GCCCCATGTGACCTCAGGCTGGG - Intronic
1122992012 14:105240957-105240979 GCCCCACGAGACCACGGGCAGGG + Intronic
1123093237 14:105751383-105751405 GCACCACGGGGCCACAGGAGTGG - Intergenic
1123719261 15:23048232-23048254 GCCCCACAGCACCACTGGCTAGG - Intergenic
1126740207 15:51769598-51769620 TCCCAAGGGGAGCACAGGGTCGG - Intronic
1128517320 15:68350854-68350876 GACCCTGGGGACCCCAGGGTGGG + Intronic
1128552650 15:68608370-68608392 CCTCCAGGGGACCACAGTGTGGG - Intronic
1132426634 15:101723924-101723946 GCCACACGGGACCACCGAGCAGG + Intronic
1132915117 16:2340054-2340076 GCTCCTCGGAACCAGAGGGTGGG + Intronic
1133102570 16:3488190-3488212 GCCCCACCGGACCGCAGAGCTGG + Intergenic
1137677455 16:50310863-50310885 GCCCAACGGCACCACCAGGTGGG + Exonic
1138525950 16:57607351-57607373 GCCCCAGGCGACTGCAGGGTTGG - Intergenic
1138543621 16:57703530-57703552 GCACCCAGGGACCCCAGGGTGGG + Intronic
1139485647 16:67255265-67255287 GCCCCAGGGGACCCAAGGGAAGG - Intronic
1141452929 16:84117415-84117437 GCCCCACGGGACGACAGACTGGG + Intergenic
1142260377 16:89039999-89040021 GCCCCTCGGGGAGACAGGGTGGG - Intergenic
1142386977 16:89771673-89771695 GAGCCACGGGAACACATGGTAGG - Exonic
1142672787 17:1494930-1494952 ACCCCCCGGGACCTCAGAGTGGG - Exonic
1144490453 17:15704340-15704362 GCCCCCTGGGGCCCCAGGGTCGG + Intronic
1146928454 17:36761587-36761609 GGACGAAGGGACCACAGGGTGGG - Intergenic
1147228132 17:38996643-38996665 GACCCCCAGGGCCACAGGGTAGG - Intergenic
1148758806 17:49988514-49988536 GCCCCAGAGGTCAACAGGGTGGG + Intergenic
1149444116 17:56700347-56700369 GCACCACGGCACCCCAGGCTGGG + Intergenic
1150325645 17:64254902-64254924 GCACCACTGCACCACAGCGTTGG - Intronic
1151433636 17:74081146-74081168 GCCCCACAGCACCTCGGGGTGGG + Intergenic
1152784158 17:82239368-82239390 GCCCCATGTGAGCCCAGGGTAGG - Exonic
1154954415 18:21241509-21241531 GCCTCCCGGGACCACGGGGACGG - Intergenic
1155918161 18:31576247-31576269 GCCCCATGGCACCACAGGGATGG + Intergenic
1159472905 18:68880071-68880093 GCCCCACGGGAGCCCATGGAGGG + Intronic
1159925829 18:74268395-74268417 GCCTCACAGGGCCCCAGGGTAGG + Intronic
1159954522 18:74510014-74510036 GCTCCACGGGGCCAGAGGTTGGG - Intronic
1160951961 19:1672057-1672079 GCACCCCCGGACCACAGGGAGGG - Intergenic
1161261179 19:3338690-3338712 GCCCCAGGGTGGCACAGGGTGGG + Intergenic
1161298652 19:3532361-3532383 GGCCTATGGGACCACAGGGCTGG + Intronic
1161301229 19:3544070-3544092 GTCCCAGGGGACCAGAGGCTCGG + Intronic
1161680700 19:5678381-5678403 GGCCCCAGGGAGCACAGGGTTGG - Intronic
1162720760 19:12661228-12661250 GCACAAGGGTACCACAGGGTAGG + Intronic
1163561630 19:18022691-18022713 GCCCCATGGGGCCACTGGGGTGG - Intergenic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1165766669 19:38355791-38355813 GATCCAGGGGCCCACAGGGTAGG + Intronic
1166851150 19:45761949-45761971 GCCCGGCGTGCCCACAGGGTTGG - Exonic
1168300370 19:55401544-55401566 GCCCCCTGGGGCCCCAGGGTCGG + Exonic
926688824 2:15718636-15718658 GCCCCAGGTGGCCACAGGATGGG - Intronic
929890830 2:45917746-45917768 GCCGCACGGGAGCTCACGGTCGG + Intronic
933812300 2:86040363-86040385 GGCACAAGGGAGCACAGGGTGGG - Intronic
937250343 2:120519707-120519729 GCCCCTGGGGAACACAGGCTAGG + Intergenic
941634948 2:167926421-167926443 ACCACAAGGGACAACAGGGTTGG + Intergenic
944711591 2:202339679-202339701 GCACCAGGGGACCAGAGGTTGGG - Intergenic
945305446 2:208255065-208255087 GAAACCCGGGACCACAGGGTAGG + Intronic
948641793 2:239379692-239379714 GCCCCAAGGAGCCCCAGGGTGGG + Intronic
948718278 2:239880343-239880365 CCCCCAGGGGACCACAGGTGAGG - Intergenic
948992619 2:241562494-241562516 GTCCCATGGGACCTCAGGGAGGG + Intronic
1171749047 20:29029437-29029459 GCCCCACGGGACCTGAGTGAAGG + Intergenic
1173589966 20:44217033-44217055 GTCCCATGGGACAACGGGGTCGG - Intergenic
1173865963 20:46312778-46312800 GGCCGACGGGACCGCAGGGAGGG + Intergenic
1174578571 20:51554981-51555003 GCCCCAGGGTTCCACAGGGATGG - Intronic
1176034929 20:63031570-63031592 GCCGCACGTGCCCACTGGGTGGG - Intergenic
1176053222 20:63131481-63131503 GCCTCACCAGAGCACAGGGTGGG + Intergenic
1176145095 20:63562012-63562034 GCCACAGGGACCCACAGGGTGGG - Intronic
1176168463 20:63686516-63686538 GCCCCACTGGAGCACAAGGCAGG - Intronic
1176316136 21:5246267-5246289 GCCCCACGGGACCTGAGTGAAGG - Intergenic
1180215179 21:46318956-46318978 GCCCCTCGGGTCCACAGGTCTGG - Intronic
1180393940 22:12312193-12312215 GCCCCACGGGACCTGAGTGAAGG - Intergenic
1180405807 22:12552557-12552579 GCCCCACGGGACCTGAGTGAAGG + Intergenic
1181026264 22:20129525-20129547 GCCCCACGGGACCACAGGGTAGG + Intronic
1183358677 22:37372379-37372401 GCCCCAAGGGACCACAGCTTCGG + Exonic
1183376365 22:37467731-37467753 GCCCCACGGGGCTGCAGGGCCGG + Intergenic
1184653153 22:45928383-45928405 GCCCCACAGGTGCACAGGGTCGG + Intronic
1184765270 22:46569051-46569073 GCTCCCCGGGATCACAGGGAGGG + Intergenic
1184876740 22:47281120-47281142 GCCCAAGGGGACCCCAGGGGTGG - Intergenic
1185292497 22:50034241-50034263 GGCCCACAGCACCACAGGGAAGG - Intronic
950421165 3:12900822-12900844 GCCCCAGGAGCCCACAGGGCTGG - Intronic
953934525 3:47028878-47028900 GCCCTACCTGACCACAGGGCAGG + Intronic
953983585 3:47425447-47425469 GCTCCACTGGGCCACAGGGTGGG - Intronic
961438278 3:126934482-126934504 GCTCCACGGGACGTCAGGGCTGG + Intronic
961752135 3:129102990-129103012 CCCCCAGGAGTCCACAGGGTGGG - Intronic
962847725 3:139286340-139286362 GCCCCTCGGGAGCACAGGAGTGG - Intronic
968519688 4:1029825-1029847 GACCCACGGGCCCATTGGGTGGG - Intergenic
972311317 4:37886317-37886339 GCACCACGGCACCCCAGCGTGGG + Intergenic
980937797 4:139242671-139242693 GCCCCCGGGGGCCACAGGGCAGG + Intergenic
984264559 4:177481548-177481570 GCCCCACTGCACCACAGCTTGGG + Intergenic
992524153 5:77590421-77590443 GCCCCAAGGGACCACACAGATGG + Intronic
997630352 5:135363362-135363384 ACCCAACGGGACAACAGGGCAGG + Intronic
1002534272 5:179867630-179867652 TCCCCAGGGGACCACGGGCTGGG - Intronic
1003073144 6:2960268-2960290 GCCCCACTGCACTACAGGGAAGG + Exonic
1003125384 6:3351704-3351726 GCCACACTGTACCACAGGGTGGG + Intronic
1006056652 6:31390135-31390157 GCCCCACAGGCACCCAGGGTAGG - Intergenic
1006512069 6:34526761-34526783 GCCCCACGGGGCCGCAGAGCGGG + Intronic
1007735643 6:43980654-43980676 GCCTCATGGGCCCACAGGTTAGG + Intergenic
1019734445 7:2643953-2643975 GTCCCACCGGAGCACAGGGTCGG + Intronic
1022503150 7:30894990-30895012 GCCCAAAGGGAACACAGCGTTGG + Intergenic
1023029284 7:36078857-36078879 GCCCCCGGGGACCAGAGGTTCGG + Intergenic
1024373268 7:48610375-48610397 GCCCCACAGAACCACAGGGGCGG - Intronic
1027024441 7:74840756-74840778 TCCCCACGGGACCACATGCCAGG + Intronic
1027063324 7:75103366-75103388 TCCCCACGGGACCACATGCCAGG - Intronic
1029664120 7:101983434-101983456 GGCCCAGGGCACCCCAGGGTGGG - Intronic
1029995157 7:105000856-105000878 GCCCCACTCCACCACAGAGTGGG + Intergenic
1034807650 7:154103000-154103022 GCCCCATGGGGTCAGAGGGTTGG + Intronic
1041588425 8:59547407-59547429 GCCGCAGGAGCCCACAGGGTGGG - Intergenic
1049543053 8:143217247-143217269 GCCCCACTGGAGCACAGTGCAGG + Intergenic
1049632630 8:143666849-143666871 GCCTCACGGGGACACAGGATGGG - Intergenic
1050917685 9:11158228-11158250 GCCCCAGGGGACCACTGAGTAGG - Intergenic
1052179327 9:25505280-25505302 GCCCCACAGAACCACAGGGGTGG - Intergenic
1060176217 9:121499352-121499374 CCCCCACGGGTCCGCGGGGTTGG - Intergenic
1060806676 9:126582072-126582094 GCACCACGTGACCACAGAGGTGG + Intergenic
1061866775 9:133495349-133495371 GCCCCAGGGGCCCCCAGGGCTGG + Intergenic
1061919808 9:133776528-133776550 GCCTCACTGGGCCACAGGCTGGG + Intronic
1062508831 9:136893560-136893582 GCCCCATGGGTCTGCAGGGTTGG + Intronic
1187117681 X:16369957-16369979 GCCCCACGAGACCACAGAGGTGG - Intergenic
1200212780 X:154354286-154354308 GCCCCACTGCCCCACAGGGGAGG - Exonic
1200281205 X:154778411-154778433 GTACCACGGGACCCCAGGCTTGG + Intergenic