ID: 1181026612

View in Genome Browser
Species Human (GRCh38)
Location 22:20131127-20131149
Sequence CGACGGCGCTGTGGGCGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 199}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181026612_1181026631 11 Left 1181026612 22:20131127-20131149 CCACCCCGCCCACAGCGCCGTCG 0: 1
1: 0
2: 1
3: 12
4: 199
Right 1181026631 22:20131161-20131183 GTCCACCTTAAGCGGCGGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 17
1181026612_1181026625 3 Left 1181026612 22:20131127-20131149 CCACCCCGCCCACAGCGCCGTCG 0: 1
1: 0
2: 1
3: 12
4: 199
Right 1181026625 22:20131153-20131175 CCGGCCCGGTCCACCTTAAGCGG 0: 1
1: 0
2: 0
3: 2
4: 33
1181026612_1181026626 6 Left 1181026612 22:20131127-20131149 CCACCCCGCCCACAGCGCCGTCG 0: 1
1: 0
2: 1
3: 12
4: 199
Right 1181026626 22:20131156-20131178 GCCCGGTCCACCTTAAGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 24
1181026612_1181026636 18 Left 1181026612 22:20131127-20131149 CCACCCCGCCCACAGCGCCGTCG 0: 1
1: 0
2: 1
3: 12
4: 199
Right 1181026636 22:20131168-20131190 TTAAGCGGCGGCGGGGCGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 249
1181026612_1181026633 14 Left 1181026612 22:20131127-20131149 CCACCCCGCCCACAGCGCCGTCG 0: 1
1: 0
2: 1
3: 12
4: 199
Right 1181026633 22:20131164-20131186 CACCTTAAGCGGCGGCGGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 63
1181026612_1181026634 15 Left 1181026612 22:20131127-20131149 CCACCCCGCCCACAGCGCCGTCG 0: 1
1: 0
2: 1
3: 12
4: 199
Right 1181026634 22:20131165-20131187 ACCTTAAGCGGCGGCGGGGCGGG 0: 1
1: 0
2: 2
3: 12
4: 59
1181026612_1181026638 30 Left 1181026612 22:20131127-20131149 CCACCCCGCCCACAGCGCCGTCG 0: 1
1: 0
2: 1
3: 12
4: 199
Right 1181026638 22:20131180-20131202 GGGGCGGGTGGGATTTCCTGCGG 0: 1
1: 0
2: 3
3: 40
4: 278
1181026612_1181026637 19 Left 1181026612 22:20131127-20131149 CCACCCCGCCCACAGCGCCGTCG 0: 1
1: 0
2: 1
3: 12
4: 199
Right 1181026637 22:20131169-20131191 TAAGCGGCGGCGGGGCGGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 205
1181026612_1181026629 9 Left 1181026612 22:20131127-20131149 CCACCCCGCCCACAGCGCCGTCG 0: 1
1: 0
2: 1
3: 12
4: 199
Right 1181026629 22:20131159-20131181 CGGTCCACCTTAAGCGGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 23
1181026612_1181026630 10 Left 1181026612 22:20131127-20131149 CCACCCCGCCCACAGCGCCGTCG 0: 1
1: 0
2: 1
3: 12
4: 199
Right 1181026630 22:20131160-20131182 GGTCCACCTTAAGCGGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181026612 Original CRISPR CGACGGCGCTGTGGGCGGGG TGG (reversed) Intronic
900145550 1:1157461-1157483 GGGCGGGGCTGCGGGCGGGGCGG - Intergenic
900182130 1:1315755-1315777 CGAGGGAGGTGGGGGCGGGGAGG + Intronic
901199166 1:7457039-7457061 CGGCGGCGCAGGGGGCGGGGCGG - Intronic
901483025 1:9539326-9539348 GGACGCGGATGTGGGCGGGGAGG - Intergenic
901934516 1:12618373-12618395 CGACGGCGCAGGGGGAGGGGAGG - Intergenic
902394510 1:16125313-16125335 TGATGTCGCTGTGGGCCGGGAGG + Exonic
902747212 1:18482021-18482043 CCACGGCCCTGTCTGCGGGGAGG - Exonic
905167027 1:36088789-36088811 GGGCGGCGCTGTGGGCCTGGCGG + Intergenic
906325583 1:44843371-44843393 CGGCGCCGCAGGGGGCGGGGCGG + Intergenic
908027545 1:59968659-59968681 GGATGGAGCTGTGGGAGGGGTGG + Intergenic
908380683 1:63594157-63594179 CGAGGGGGCTCTGGGCGAGGCGG - Intronic
909548000 1:76868482-76868504 CCATGGCGCTGCGGGCGGGCGGG - Exonic
911078918 1:93909191-93909213 CGAAGGGGCTGCGGGCGGGCGGG + Exonic
912386499 1:109273561-109273583 TGCCGGGGCGGTGGGCGGGGAGG - Exonic
912993427 1:114510899-114510921 GGCCGGCGCTGAGGGCGGCGCGG - Exonic
919118639 1:193312642-193312664 CGAGGGCTTTGTGGGTGGGGAGG + Intergenic
921355590 1:214281529-214281551 CGCCGGCCCTTGGGGCGGGGTGG + Intronic
1062838704 10:652898-652920 CGAGGTAGCTGTGGGCGGGGAGG - Intronic
1062932594 10:1362976-1362998 GGGCGGCGCTGGGGGCGCGGGGG - Intronic
1067110307 10:43395944-43395966 AGAAAGCGCTGGGGGCGGGGAGG + Intronic
1069445736 10:68471778-68471800 CGGCGGAGCTGTGAGCGGAGAGG - Exonic
1069659618 10:70114971-70114993 CCACGGCGATGTTGGCGTGGAGG + Exonic
1071544853 10:86521557-86521579 CGGCGGCGCTCGAGGCGGGGAGG - Exonic
1076749890 10:132537420-132537442 CCGCGGCGCGGGGGGCGGGGCGG + Intergenic
1077053016 11:576118-576140 GGACGGGGCTGCGGGCGTGGGGG + Intergenic
1077074874 11:695800-695822 CGACGGACCGGCGGGCGGGGCGG + Exonic
1077168221 11:1153203-1153225 GGTCGGCGCTGCGGGCAGGGTGG + Intergenic
1077360347 11:2138000-2138022 CGGCGGAGCTGGGGGTGGGGTGG - Intronic
1079361935 11:19777094-19777116 CGAGGGCGGGGTGGGGGGGGGGG - Intronic
1081207684 11:40293839-40293861 CGATGGCGCTAAGGGCGGCGCGG - Exonic
1081938135 11:46918590-46918612 CTGCGGCGCGGGGGGCGGGGCGG - Exonic
1083663205 11:64261674-64261696 TGAAGGTGCTGTGGGCGGGCAGG + Intronic
1085346026 11:75768708-75768730 CGCCGACGCGGCGGGCGGGGCGG - Intronic
1086993424 11:93330585-93330607 CGGCGGCGCCGCGCGCGGGGAGG + Intronic
1091730498 12:2877038-2877060 CCCCGGCGGTGCGGGCGGGGTGG + Intronic
1091823255 12:3491743-3491765 CGGCGGCGCGGTGGTCCGGGTGG - Intronic
1092487442 12:8914666-8914688 CGGGGGCGCCGAGGGCGGGGTGG - Exonic
1095949272 12:47773162-47773184 GGGCGGCGCTGGGGGCGGGCCGG + Intronic
1096159859 12:49367403-49367425 AGGCGGCGGTGGGGGCGGGGCGG + Intronic
1096627341 12:52903875-52903897 CGGGGGCGGTGTGGGTGGGGTGG - Intronic
1096788911 12:54033338-54033360 CCGCGGCGCTGCAGGCGGGGCGG - Exonic
1096946730 12:55414975-55414997 CGGGGGCGCCGAGGGCGGGGTGG + Intergenic
1100631991 12:96399452-96399474 CGCTGGCGCTGTGCGCGGGTGGG - Intronic
1103953805 12:124566087-124566109 GGAGGACCCTGTGGGCGGGGTGG - Intronic
1107851471 13:44576725-44576747 CGACGCGGCTGCGAGCGGGGCGG + Intronic
1108403978 13:50081606-50081628 AGACGGGGCTGTGGGGGGAGGGG - Intergenic
1111672465 13:91348067-91348089 CGGCGGCGGCGTGGCCGGGGCGG + Intergenic
1113737889 13:112690723-112690745 CCAGGGCGCTGCGGGCGGGAAGG - Intronic
1113894169 13:113752834-113752856 CGCCGGCTCTGTGGCCGAGGAGG + Intergenic
1115753706 14:36514251-36514273 CGACGGTGCTGTAGGGGCGGAGG + Intergenic
1116887063 14:50231729-50231751 GGGCGGCGCTGTCGGCTGGGAGG - Intergenic
1119742945 14:77026194-77026216 CGACGGCGCGGCGGGCGGCAAGG + Exonic
1119932975 14:78566146-78566168 GGCCGGCGTTGGGGGCGGGGTGG - Intronic
1120190624 14:81436429-81436451 CGTCGGCGCTGCGGCCGGGAGGG - Intronic
1123019659 14:105391718-105391740 CGACGGGGAGGAGGGCGGGGTGG - Exonic
1124625156 15:31303550-31303572 GGAAGGCTGTGTGGGCGGGGTGG - Intergenic
1125674759 15:41495973-41495995 CGACGGCTCGGAGGGCGGCGGGG - Intronic
1125709649 15:41774569-41774591 CGAGGGCGCTGTGAGCGGGGTGG + Exonic
1126849038 15:52786640-52786662 GGACGGCACTGTGGAGGGGGAGG - Intronic
1127988744 15:64095851-64095873 CTTAGGCGCTGGGGGCGGGGCGG - Intronic
1129710983 15:77820084-77820106 CGAGCGCGCAGTGGGCGGCGAGG + Intronic
1130370949 15:83284781-83284803 CGACCGCGCGGTGGGCGGAGGGG - Intergenic
1132519712 16:381643-381665 GGCCGGGGCTGCGGGCGGGGCGG - Intronic
1132752734 16:1466269-1466291 GGACGGCGTTGGGGGCCGGGAGG - Intronic
1133197862 16:4183875-4183897 CGTGGGCGCTGGGGGCGGGGCGG - Intergenic
1135517619 16:23148953-23148975 CGGCGGCGGCGTGGGCGCGGCGG + Exonic
1136957425 16:34802922-34802944 CGGCAGCGGAGTGGGCGGGGGGG - Intergenic
1141538558 16:84700270-84700292 CGAAGGCGCGGCGGGCGCGGAGG - Intronic
1142752679 17:1998128-1998150 CGGCGGCGGAGGGGGCGGGGAGG + Intronic
1142980560 17:3668754-3668776 CGCAGGCGCGGAGGGCGGGGCGG + Intronic
1143390485 17:6556613-6556635 CGGCGGCGCGGGGGGTGGGGTGG - Intergenic
1144784363 17:17823666-17823688 GGGCGGGGCTGGGGGCGGGGCGG - Intronic
1145690309 17:26732186-26732208 CGAGGGGCCCGTGGGCGGGGTGG + Intergenic
1147110467 17:38257437-38257459 CGAGGGCGCGGCCGGCGGGGCGG + Intergenic
1148419040 17:47530994-47531016 CGAGGGCGCGGCCGGCGGGGCGG - Intronic
1148568316 17:48646776-48646798 CGACGGCGCTGGGGGCGCGAAGG + Intergenic
1150216834 17:63476017-63476039 CGGCGGCGCAGTGGGAGGTGGGG - Intergenic
1150217336 17:63477842-63477864 CCACGGTGCTGGGGGAGGGGAGG - Intergenic
1151703161 17:75753910-75753932 CGACGGCGGCGCGGGCGGGAAGG + Exonic
1151765645 17:76132044-76132066 CCTGGGGGCTGTGGGCGGGGTGG + Intergenic
1151855085 17:76715298-76715320 CAAGGGGGCTGTGGGCGTGGGGG + Exonic
1152214431 17:79024289-79024311 CGGAGGTGCTGTGGGTGGGGGGG + Exonic
1152644866 17:81464066-81464088 GGAGGGCGCTGTGGGTGGGGCGG - Exonic
1152714476 17:81891867-81891889 CGAGGGCGCAGGGGGTGGGGCGG + Intronic
1152771631 17:82173122-82173144 TGCTGGGGCTGTGGGCGGGGAGG + Intronic
1152812577 17:82388893-82388915 CGACGGTGAAGTGGGTGGGGGGG - Intergenic
1154274506 18:12947816-12947838 TGACGGGCCTGGGGGCGGGGCGG + Intronic
1156325533 18:36071506-36071528 CCAAGGGGCTGGGGGCGGGGGGG + Intergenic
1157593328 18:48849001-48849023 TGACGGGGATGTGGGCGGGCTGG - Intronic
1158649416 18:59272937-59272959 CGCCGGGGCTGGCGGCGGGGAGG + Exonic
1158893660 18:61894531-61894553 CCGCCGGGCTGTGGGCGGGGAGG - Intergenic
1160774267 19:847971-847993 GGCCAGCGCTGTGGGAGGGGCGG - Exonic
1160776863 19:860602-860624 CGGCGCCGCTGTGGGTGGGCGGG - Exonic
1161605363 19:5211929-5211951 GGAGGCTGCTGTGGGCGGGGTGG - Intronic
1162341891 19:10096287-10096309 CGACGGCGCCGTGGCCGGCGAGG - Exonic
1162588506 19:11576219-11576241 TGAGGGCCCTGTGGGTGGGGTGG - Intronic
1163503293 19:17688421-17688443 CGGGGGCGCTGCGGGCTGGGGGG + Intergenic
1163748250 19:19060601-19060623 CGACGGGGATGGGGGCTGGGGGG - Intergenic
1165345968 19:35249021-35249043 CGATGGCGCTGTTGGCCGGCGGG + Exonic
1165668660 19:37655792-37655814 AGGCGTCGCTGGGGGCGGGGCGG - Intronic
1165845058 19:38812799-38812821 GGACGGAGCTGCGGGCGGAGTGG + Intronic
1166317452 19:41997160-41997182 GGGGGGCGCTGTGTGCGGGGAGG + Intronic
927698361 2:25252294-25252316 CGATGGGGCTGGGGGCGGAGGGG + Intronic
928094397 2:28394713-28394735 GGAAGGTGCTGTTGGCGGGGGGG + Intronic
932231465 2:70087466-70087488 CCTCGGCGGTCTGGGCGGGGCGG - Exonic
932476996 2:72012677-72012699 CGAAGGCACAGTGGGAGGGGTGG + Intergenic
934304580 2:91810366-91810388 CCGCGGCACGGTGGGCGGGGGGG - Intergenic
934328677 2:92042384-92042406 CCGCGGCACGGTGGGCGGGGGGG + Intergenic
934686427 2:96325264-96325286 CCACGGGGGTTTGGGCGGGGAGG + Intergenic
934993187 2:98935869-98935891 CGAAGGCGGGGTGGGCGCGGGGG - Intronic
935196486 2:100819793-100819815 CGCCGGGGCTGGGGGAGGGGGGG - Intergenic
935746507 2:106194081-106194103 CGGCGCCGCGGTGGGCCGGGCGG - Intronic
937993288 2:127675593-127675615 CGGCGGGGCTGTGGGGGTGGGGG - Intronic
939969660 2:148644962-148644984 CGGCGGCGGGGCGGGCGGGGAGG - Exonic
948958784 2:241315870-241315892 CGCCTGCGCGCTGGGCGGGGCGG + Exonic
1168756771 20:324177-324199 CCGCGGCGCGGGGGGCGGGGTGG - Intergenic
1168965088 20:1894251-1894273 CGGGGGCGCGGGGGGCGGGGGGG - Exonic
1172118005 20:32583406-32583428 GGACGGGGCTGAGCGCGGGGCGG + Intronic
1175847125 20:62065043-62065065 CGAGGGCGCGGCGGGCGCGGGGG + Exonic
1175872813 20:62216479-62216501 CGTAGGCGCTGAGGCCGGGGAGG - Exonic
1176084022 20:63287786-63287808 CGACGGCGGGGAGGGCGGGGAGG + Exonic
1176163640 20:63661549-63661571 GGATGGCGCTGAGGGTGGGGTGG + Intronic
1176234823 20:64049344-64049366 GGACTGCGCTGCGGGCTGGGCGG + Exonic
1180090400 21:45531144-45531166 CCACGGGGCAGGGGGCGGGGAGG + Intronic
1180090422 21:45531188-45531210 CCACGGGGCAGGGGGCGGGGAGG + Intronic
1181026612 22:20131127-20131149 CGACGGCGCTGTGGGCGGGGTGG - Intronic
1182295523 22:29309564-29309586 CACTGCCGCTGTGGGCGGGGAGG + Intronic
1184741080 22:46429420-46429442 CGGCGTGGCTGTGGGCGTGGGGG + Intronic
949981664 3:9505943-9505965 CGAGTGTGCTGTGGGCTGGGGGG - Intronic
950072622 3:10164852-10164874 CGGCGGGGAAGTGGGCGGGGCGG - Exonic
953916248 3:46922863-46922885 AGAGGGTGCTGTGGGCCGGGAGG - Intronic
954004217 3:47578863-47578885 CGGCGGCGCGGGAGGCGGGGAGG - Exonic
954076857 3:48188008-48188030 CGAGGCCGGTGTCGGCGGGGCGG - Exonic
957076044 3:75603937-75603959 CGGGGGCGCTGAGGGCGTGGGGG + Intergenic
958936397 3:100260751-100260773 CCACGGTGCCGCGGGCGGGGCGG - Intergenic
960972559 3:123150242-123150264 CGTGGGCTCTGGGGGCGGGGGGG - Exonic
961013395 3:123449803-123449825 GGGCGGCGCGGGGGGCGGGGAGG - Intergenic
961541991 3:127606410-127606432 CGATTGTGGTGTGGGCGGGGAGG + Intronic
965576416 3:170222527-170222549 GGTCGGCGCTGCGGGCGAGGTGG + Exonic
965596748 3:170418686-170418708 GGACTGCGCTGCGGACGGGGTGG + Intergenic
965757626 3:172040892-172040914 CGGCGGCGCCTTTGGCGGGGAGG + Intronic
966015332 3:175132411-175132433 CGACGGGTCTGTTGGCCGGGTGG + Intronic
966182289 3:177197848-177197870 CCGCGGCGGTGGGGGCGGGGCGG - Intergenic
966619732 3:181951049-181951071 AGAAGGCGTTGTGGGTGGGGTGG + Intergenic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
969423925 4:7112804-7112826 GGCCGGAGCTGTGGGAGGGGTGG - Intergenic
969504546 4:7576697-7576719 CGAAGCTACTGTGGGCGGGGAGG + Intronic
971136059 4:23869665-23869687 GCACGGCGGGGTGGGCGGGGGGG + Intronic
972287465 4:37662790-37662812 AGACGGAGCTTTGGGCGAGGTGG - Intronic
976184192 4:82429336-82429358 TGACGGAGCTGTCGGCAGGGGGG + Exonic
977719018 4:100217149-100217171 TGGCGGCACTGGGGGCGGGGAGG - Intergenic
981782628 4:148444765-148444787 CGCCGCCGCTGGGGGCGGGCGGG - Intergenic
985504978 5:273677-273699 TCACTGCGCTGTGGGTGGGGGGG + Intronic
985595179 5:784755-784777 GGGCGGGGCTGGGGGCGGGGCGG - Intergenic
985743140 5:1631949-1631971 TCACTGCGCTGTGGGTGGGGGGG - Intergenic
987132482 5:14872053-14872075 CGGCGGCGCTGAGGGCGCGGCGG + Intergenic
992089240 5:73303187-73303209 CGACGGCGCTGTGGGCCCCGAGG - Intergenic
996403700 5:123087734-123087756 CCACGGCGCTGTGGTCCCGGAGG - Intergenic
997584094 5:135034447-135034469 CGAGGCCGCGGGGGGCGGGGAGG - Intronic
998334715 5:141361353-141361375 AGACGGCGCTCTGGACCGGGAGG + Exonic
1001529947 5:172454590-172454612 CGGCGGCGCGGGGGGCGGTGCGG - Intergenic
1002296097 5:178232258-178232280 AGACGGCGCTGTCGGGGAGGCGG + Intronic
1002527071 5:179820802-179820824 CGACGGTGGCGGGGGCGGGGAGG + Exonic
1002643807 5:180643307-180643329 GGAGGGCACTGTGGGTGGGGTGG + Intronic
1005040460 6:21595640-21595662 CGAGGGCGCGCTGGACGGGGCGG - Exonic
1006503489 6:34473216-34473238 AGACGGGGCGGGGGGCGGGGGGG + Intronic
1013330440 6:109094993-109095015 AGAAGGCGCTGGGGCCGGGGCGG - Intergenic
1013491059 6:110646589-110646611 CAACGGCGGAGGGGGCGGGGAGG + Intronic
1014913186 6:127118123-127118145 CGCCGGCGCTGGGGATGGGGTGG + Intergenic
1015366266 6:132401186-132401208 CGACATCGTCGTGGGCGGGGTGG - Exonic
1017324670 6:153131288-153131310 GGAGGGAGCGGTGGGCGGGGAGG + Intergenic
1018876778 6:167827576-167827598 CGGCGGCGCGGGGGGCGCGGCGG + Intronic
1018898145 6:168035450-168035472 GAACGGCGCTGCGGGGGGGGCGG + Intronic
1019159234 6:170058143-170058165 AGACAGGGCTGGGGGCGGGGCGG - Intergenic
1019395858 7:817100-817122 CGGCGGGGCCGTGGGTGGGGTGG + Intronic
1019989550 7:4682244-4682266 CGGCGGCGCGGGGGGCGGGGAGG - Intergenic
1020023656 7:4883696-4883718 CGGCGGCGCAACGGGCGGGGCGG + Exonic
1020177891 7:5897556-5897578 CGACGGGGGGGGGGGCGGGGGGG + Intergenic
1020212296 7:6165979-6166001 GGGCGCCGGTGTGGGCGGGGTGG - Intronic
1021828057 7:24573766-24573788 CGGCGGCGCCGCGGTCGGGGAGG + Intronic
1023220565 7:37916920-37916942 CGACGGGCCTGGGGGTGGGGCGG - Intronic
1023874587 7:44279984-44280006 CTACGACGCTGTGTGCTGGGTGG - Intronic
1025320485 7:58088507-58088529 CGAGGGTCCAGTGGGCGGGGTGG + Intergenic
1025478791 7:60957494-60957516 CGAGGGGCCCGTGGGCGGGGTGG + Intergenic
1025553264 7:62275199-62275221 CGAGGGGCCCGTGGGCGGGGTGG - Intergenic
1027233033 7:76282896-76282918 CGACGGGGCGGGCGGCGGGGTGG + Intronic
1029276768 7:99409754-99409776 AGGAGGCTCTGTGGGCGGGGGGG + Intronic
1029399738 7:100336352-100336374 CGCGTGCGCAGTGGGCGGGGGGG - Intronic
1030115256 7:106058053-106058075 GGACGGCGCAGGGGGCGCGGTGG + Intergenic
1034413321 7:150952508-150952530 GGACGGCGATGCGGCCGGGGTGG + Exonic
1034446035 7:151114827-151114849 CGCAGACGCTGTGGGCGCGGCGG - Intronic
1035265175 7:157686061-157686083 CGCCGGGGCTGAGGGCGAGGAGG + Intronic
1035266827 7:157693729-157693751 CGAGGTCGCCGCGGGCGGGGAGG - Intronic
1035403914 7:158586740-158586762 CGGCGGCGCTGCCCGCGGGGGGG + Intronic
1037947658 8:22999396-22999418 CGGCGTCGCTGCGGGAGGGGCGG + Intronic
1040047088 8:42975185-42975207 CGGCGGCGCTGAGGGCTTGGTGG - Intronic
1040471260 8:47737635-47737657 CTCCGGCGACGTGGGCGGGGTGG + Exonic
1049008949 8:139874711-139874733 AGAAGGCGCTGTGGGCAGTGGGG + Intronic
1049271490 8:141698545-141698567 AGAAAGCGCTGTGGGCCGGGAGG - Intergenic
1049537577 8:143189507-143189529 CCACGGGGGTGGGGGCGGGGAGG - Intergenic
1052051046 9:23850237-23850259 CGGGGGTGCTGGGGGCGGGGGGG - Intergenic
1054308519 9:63449482-63449504 CGTCGGCGGTGGGGGGGGGGGGG + Intergenic
1058687205 9:107489488-107489510 CGCAGGGGCTGTGGCCGGGGCGG + Exonic
1059327539 9:113513291-113513313 CAACGGCGGTGTGGGGGGAGGGG - Intronic
1060359395 9:122940941-122940963 AGACGGGGCAGGGGGCGGGGCGG + Intronic
1061500290 9:130997975-130997997 GGATGGCACTGTGGGTGGGGTGG - Intergenic
1061542057 9:131282896-131282918 CGGCGTCGGGGTGGGCGGGGCGG - Intergenic
1185512012 X:670736-670758 AGACGGGGCTGGGGGGGGGGGGG + Intergenic
1185648094 X:1629313-1629335 AGAGGGAGCTGTGGGGGGGGAGG + Intronic
1187332649 X:18354723-18354745 CGGCCGCGCGGGGGGCGGGGCGG - Exonic
1200076109 X:153552012-153552034 GGAGAGCGCTGTGGGTGGGGCGG - Intronic
1200080851 X:153575634-153575656 CCACGGGGCTGGGGCCGGGGGGG + Intronic
1200155038 X:153970723-153970745 CCACGGCGCGGTGGCCGTGGCGG + Exonic