ID: 1181026792

View in Genome Browser
Species Human (GRCh38)
Location 22:20131642-20131664
Sequence GGGGCAGGACCCCGCGGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181026792_1181026802 2 Left 1181026792 22:20131642-20131664 CCGAGGCCGCGGGGTCCTGCCCC No data
Right 1181026802 22:20131667-20131689 CCGAAGGTCCCGCGAACCGGTGG No data
1181026792_1181026800 -1 Left 1181026792 22:20131642-20131664 CCGAGGCCGCGGGGTCCTGCCCC No data
Right 1181026800 22:20131664-20131686 CCTCCGAAGGTCCCGCGAACCGG No data
1181026792_1181026806 12 Left 1181026792 22:20131642-20131664 CCGAGGCCGCGGGGTCCTGCCCC No data
Right 1181026806 22:20131677-20131699 CGCGAACCGGTGGCGGTCCCCGG No data
1181026792_1181026803 5 Left 1181026792 22:20131642-20131664 CCGAGGCCGCGGGGTCCTGCCCC No data
Right 1181026803 22:20131670-20131692 AAGGTCCCGCGAACCGGTGGCGG No data
1181026792_1181026807 13 Left 1181026792 22:20131642-20131664 CCGAGGCCGCGGGGTCCTGCCCC No data
Right 1181026807 22:20131678-20131700 GCGAACCGGTGGCGGTCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181026792 Original CRISPR GGGGCAGGACCCCGCGGCCT CGG (reversed) Intronic