ID: 1181027002

View in Genome Browser
Species Human (GRCh38)
Location 22:20132260-20132282
Sequence CGCACTGGTGTCCCCACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 106}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181027002_1181027015 17 Left 1181027002 22:20132260-20132282 CCTTGTGTGGGGACACCAGTGCG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1181027015 22:20132300-20132322 GTGTCCAGGCAGGCCCTGGCGGG 0: 1
1: 1
2: 14
3: 54
4: 353
1181027002_1181027016 18 Left 1181027002 22:20132260-20132282 CCTTGTGTGGGGACACCAGTGCG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1181027016 22:20132301-20132323 TGTCCAGGCAGGCCCTGGCGGGG 0: 1
1: 0
2: 2
3: 27
4: 364
1181027002_1181027009 -7 Left 1181027002 22:20132260-20132282 CCTTGTGTGGGGACACCAGTGCG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1181027009 22:20132276-20132298 CAGTGCGGGCTGGGCACCTCGGG 0: 1
1: 0
2: 1
3: 16
4: 174
1181027002_1181027013 13 Left 1181027002 22:20132260-20132282 CCTTGTGTGGGGACACCAGTGCG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1181027013 22:20132296-20132318 GGGAGTGTCCAGGCAGGCCCTGG 0: 1
1: 1
2: 3
3: 40
4: 466
1181027002_1181027018 26 Left 1181027002 22:20132260-20132282 CCTTGTGTGGGGACACCAGTGCG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1181027018 22:20132309-20132331 CAGGCCCTGGCGGGGAGCGCTGG 0: 1
1: 0
2: 0
3: 48
4: 460
1181027002_1181027014 16 Left 1181027002 22:20132260-20132282 CCTTGTGTGGGGACACCAGTGCG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1181027014 22:20132299-20132321 AGTGTCCAGGCAGGCCCTGGCGG 0: 1
1: 0
2: 4
3: 37
4: 449
1181027002_1181027019 27 Left 1181027002 22:20132260-20132282 CCTTGTGTGGGGACACCAGTGCG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1181027019 22:20132310-20132332 AGGCCCTGGCGGGGAGCGCTGGG No data
1181027002_1181027010 3 Left 1181027002 22:20132260-20132282 CCTTGTGTGGGGACACCAGTGCG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1181027010 22:20132286-20132308 TGGGCACCTCGGGAGTGTCCAGG 0: 1
1: 0
2: 0
3: 16
4: 153
1181027002_1181027008 -8 Left 1181027002 22:20132260-20132282 CCTTGTGTGGGGACACCAGTGCG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1181027008 22:20132275-20132297 CCAGTGCGGGCTGGGCACCTCGG 0: 1
1: 0
2: 1
3: 24
4: 333
1181027002_1181027011 7 Left 1181027002 22:20132260-20132282 CCTTGTGTGGGGACACCAGTGCG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1181027011 22:20132290-20132312 CACCTCGGGAGTGTCCAGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181027002 Original CRISPR CGCACTGGTGTCCCCACACA AGG (reversed) Intronic
900130806 1:1086387-1086409 GGCCCTGGGGCCCCCACACAGGG + Intronic
901140227 1:7024308-7024330 CACCCTGATGTGCCCACACATGG - Intronic
901223165 1:7595632-7595654 CTCACTGGTGTCACCTCAGAGGG - Intronic
901489858 1:9591131-9591153 CGCCCTGGCTTCCCCACGCATGG + Intronic
903029665 1:20454074-20454096 CACACTGGTGCACACACACACGG - Intergenic
903661025 1:24978708-24978730 AGCTCTGGAGGCCCCACACACGG - Intergenic
907474818 1:54698648-54698670 CCCACTGGCCTCCCCACCCACGG - Intronic
916605802 1:166342212-166342234 CTCGCTGGTGTCCCCATCCACGG - Intergenic
1063454791 10:6175430-6175452 AGCACTGTGGTCCCCACACTCGG - Intronic
1069609743 10:69764982-69765004 CGACCAGGTGTCCACACACAGGG + Intergenic
1071515135 10:86292055-86292077 GGCACTGGGGCCCACACACAGGG + Intronic
1076705412 10:132298616-132298638 CTCCCCGGTGACCCCACACAGGG - Intronic
1077240734 11:1509118-1509140 CCAACAGCTGTCCCCACACAGGG + Intergenic
1078590470 11:12636852-12636874 AGAGCTGGTGTCCCCAGACAGGG + Intergenic
1090080480 11:123609181-123609203 CTCATCGGTGTCCACACACAGGG - Intronic
1094439162 12:30455962-30455984 GGCACAGGTGTTCCCACAGAAGG + Intergenic
1099364940 12:81757672-81757694 CCCACTGGAGTCCTCACTCAAGG + Intronic
1105773424 13:23634585-23634607 TGCATTGGTGGCCACACACATGG + Intronic
1107959517 13:45545745-45545767 GACACAGGTGTCCCTACACAGGG - Intronic
1113064638 13:106360570-106360592 CAAACTCGTGTCCCCACAGAGGG - Intergenic
1113655171 13:112063370-112063392 CGCTCTGGTGTCGCCCCAGAGGG - Intergenic
1118926011 14:70189948-70189970 TGCACTGGTGTCGCTACAGAAGG - Intergenic
1119380367 14:74224462-74224484 CCTACTGGAGTCCCCACACCAGG + Intergenic
1121664134 14:95659030-95659052 CCCACTGATGCCCCCAAACAGGG - Intergenic
1122302553 14:100739210-100739232 CCCTCTGGTCTCCCCACCCAAGG + Intergenic
1122556847 14:102585223-102585245 GGCCCTGGTGTCCCCACTCCTGG - Intergenic
1124442756 15:29699842-29699864 CGCACGTGTGTCCCCATGCAGGG + Exonic
1127137897 15:55943720-55943742 GGGACTGGAGTCCCCACACAGGG + Intronic
1127833235 15:62769270-62769292 GGCACTGGTGTCACCACCAAAGG - Intronic
1129523163 15:76198419-76198441 CACACTGTTGGCCTCACACAGGG - Intronic
1129566220 15:76625798-76625820 CGCACTTCTTTCCCCACACTGGG + Intronic
1130484009 15:84387448-84387470 CGCACTGATGTCCCCTCCCCTGG + Intergenic
1141506357 16:84481096-84481118 GGCACTGGGGCCCCAACACAGGG - Intronic
1142073799 16:88105904-88105926 GGCCCTGCTGTCCACACACAAGG - Intronic
1144727458 17:17508940-17508962 AGCCCTGATGTCCCCGCACAAGG + Intronic
1144735466 17:17553099-17553121 GGCTTTGCTGTCCCCACACACGG + Intronic
1145101170 17:20079197-20079219 TGCAGTTGCGTCCCCACACACGG + Intronic
1146679986 17:34800124-34800146 TGGACTTCTGTCCCCACACAGGG + Intergenic
1148243185 17:46013221-46013243 CCCTCAGGTGACCCCACACAAGG + Intronic
1148860505 17:50602020-50602042 CGCACTGGGGACCTCACACCCGG + Intronic
1149287873 17:55185957-55185979 TGCTCTGGTGCCTCCACACATGG - Intergenic
1151351606 17:73535151-73535173 CCCCCTGCTGTCCTCACACATGG - Intronic
1152759317 17:82099681-82099703 CGCACTGCTGTCCCCACTGCGGG + Intergenic
1155128873 18:22909960-22909982 AGGACTGGTTTCCCCCCACAGGG - Intronic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1160538812 18:79609690-79609712 GCCACTGGTGTCCCCAGAAAAGG + Intergenic
1161112360 19:2477416-2477438 CTGACTGTTTTCCCCACACAGGG + Intronic
1162781835 19:13010692-13010714 CGCTCTGGTGCCCACACACATGG + Intronic
926421742 2:12706822-12706844 AGGACTGGTGTCCCCACAACAGG + Intergenic
930164691 2:48192905-48192927 CAGACTGGTGTGCACACACAGGG + Intergenic
932741282 2:74292910-74292932 CGCACTGCTGGCCCCTGACATGG + Intronic
933689041 2:85165270-85165292 CGCACATGTGTGCACACACACGG - Intronic
934976775 2:98808483-98808505 GGCACTGTTGTCCCCAGAAAGGG - Intronic
935385731 2:102498344-102498366 CACACTGGTGTCCAGAGACAAGG + Intronic
943892313 2:193305609-193305631 CGCACTGTTTTTCCCACACTAGG - Intergenic
947230060 2:227875519-227875541 GGCAGAGGTGTCCCCACCCAGGG + Intronic
948297087 2:236868713-236868735 CACACTGGTCTCCCCACTTATGG + Intergenic
1175759887 20:61555012-61555034 CACACAGGTGTGCACACACATGG - Intronic
1176135360 20:63520074-63520096 CGCTCTGGGCTCCCCAAACATGG + Intergenic
1176295418 21:5069584-5069606 CACACGGGGGTCCCCACCCAAGG - Intergenic
1178431181 21:32520143-32520165 CCCACTGCTGACCCCACAAATGG + Intergenic
1179861632 21:44192540-44192562 CACACGGGGGTCCCCACCCAAGG + Intergenic
1180832761 22:18914477-18914499 AGCACTGGGGTCCCCACCCTGGG + Intronic
1180836826 22:18934107-18934129 CCCACTGCTGTCCCCATCCAAGG + Intronic
1181027002 22:20132260-20132282 CGCACTGGTGTCCCCACACAAGG - Intronic
1182356895 22:29726242-29726264 CCCACTGGTGTCCACACCCAAGG - Intronic
1203282846 22_KI270734v1_random:139781-139803 AGCACTGGGGTCCCCACCCTGGG + Intergenic
1203286919 22_KI270734v1_random:159406-159428 CCCACTGCTGTCCCCATCCAAGG + Intergenic
950992816 3:17459110-17459132 CTCTATGGTGTCCACACACAAGG - Intronic
952210559 3:31225478-31225500 CTCACTCCTGACCCCACACAAGG - Intergenic
952367254 3:32685561-32685583 CGCCCTGGAGTCCCCACCCCGGG - Intronic
953655347 3:44847465-44847487 GGCCCTGGTGTCCACATACACGG + Intronic
954875773 3:53802384-53802406 AGGACTGGTGTCCACACACAAGG + Intronic
955904350 3:63790972-63790994 CTCAGAGTTGTCCCCACACAAGG + Intergenic
958444228 3:94195038-94195060 CACACTGGGGTACTCACACAGGG + Intergenic
960683164 3:120270214-120270236 TGCCCTGGTCTCCCCAGACATGG + Intronic
961091264 3:124114588-124114610 GACACTGGTGTCCTCACAGAGGG + Intronic
961563959 3:127750134-127750156 CGCAGTCTAGTCCCCACACACGG - Intronic
964220402 3:154338050-154338072 CACACTGGTGTCCACAAACGTGG + Exonic
966565942 3:181381336-181381358 CTGTCTAGTGTCCCCACACAGGG - Intergenic
969618012 4:8265022-8265044 TGCACTGCTGTCCCCACCCGTGG + Intergenic
980794594 4:137664612-137664634 CTCATTGGTGTCTCCAAACAAGG - Intergenic
985763343 5:1763145-1763167 GGCACTGGTGTCTCCAGACCTGG + Intergenic
985969355 5:3362753-3362775 GGCACTGGTGTCCCTACTCCAGG - Intergenic
990373270 5:55142614-55142636 TGCACTGGTGGCCTCAAACATGG - Intronic
994157819 5:96523203-96523225 CTGCCTGGTGTGCCCACACATGG + Intergenic
997476239 5:134144214-134144236 AGCCGTGCTGTCCCCACACAGGG + Intronic
999284059 5:150383517-150383539 TGCACTGGTGCCAGCACACAAGG + Intronic
1000676927 5:164132619-164132641 GGTATTGATGTCCCCACACAGGG + Intergenic
1001288129 5:170438349-170438371 TGCCCTGCTGTCCCCACACGAGG - Intronic
1003198608 6:3938199-3938221 CCCACTGCTGCCCCCAGACATGG - Intergenic
1010141719 6:72621466-72621488 GGCACTCGGGTCCCCGCACACGG - Intergenic
1011294063 6:85808096-85808118 GGCATTGGAGCCCCCACACAGGG - Intergenic
1018686232 6:166307121-166307143 CGCACTGGTGTCCCGAAAGTGGG + Exonic
1019409560 7:900659-900681 AGCGCTGGGGTCCCCACAGAGGG + Intronic
1019481810 7:1270377-1270399 CGCCATGGTGTCCCCACTCCAGG + Intergenic
1022130082 7:27396985-27397007 CACACTCCTGTCCCCACTCATGG + Intergenic
1024920520 7:54549349-54549371 TGCACTTGTATCCCCACACTGGG - Intronic
1029659638 7:101951374-101951396 GGGACTGGTGTTCCCAGACATGG - Intronic
1032491534 7:132327941-132327963 CTCACCTGTGTCCCCACACAGGG - Intronic
1038834803 8:31107474-31107496 CGCACTGGAGGCCCAACAGAAGG - Intronic
1045040211 8:98216436-98216458 AGCACTTGTGTGTCCACACAAGG - Intronic
1048794475 8:138137379-138137401 CACACTAGTGTCATCACACAAGG + Intronic
1049256310 8:141615752-141615774 CGCACTGTGGACCCCACTCAGGG - Intergenic
1055472332 9:76624968-76624990 AACACTGGTGTACACACACAGGG + Intronic
1061287010 9:129629599-129629621 CACACTGGTGTCCCAGCACTGGG - Intronic
1061480471 9:130895567-130895589 GGCACTGGTGTCCCCTCTCCGGG + Intergenic
1061878471 9:133556673-133556695 TGCCCAGGTGTCCCCAGACATGG - Intronic
1200409606 Y:2848286-2848308 GGCACTAGTCTCCCCACTCATGG - Intronic
1201898553 Y:19021202-19021224 CCCAGTGGTGTCCTCACCCAGGG - Intergenic
1202374068 Y:24217848-24217870 CGCACTGATGTCCCCTCCCCTGG - Intergenic
1202496713 Y:25452272-25452294 CGCACTGATGTCCCCTCCCCTGG + Intergenic