ID: 1181027145

View in Genome Browser
Species Human (GRCh38)
Location 22:20132749-20132771
Sequence GTGAAGAAGTTGAGGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 465}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181027145_1181027154 9 Left 1181027145 22:20132749-20132771 CCCTCCAGCCTCAACTTCTTCAC 0: 1
1: 0
2: 3
3: 43
4: 465
Right 1181027154 22:20132781-20132803 AGGCTGGCTTAGGACCAGAGAGG No data
1181027145_1181027152 -1 Left 1181027145 22:20132749-20132771 CCCTCCAGCCTCAACTTCTTCAC 0: 1
1: 0
2: 3
3: 43
4: 465
Right 1181027152 22:20132771-20132793 CCCAAGATACAGGCTGGCTTAGG 0: 1
1: 0
2: 0
3: 16
4: 148
1181027145_1181027150 -7 Left 1181027145 22:20132749-20132771 CCCTCCAGCCTCAACTTCTTCAC 0: 1
1: 0
2: 3
3: 43
4: 465
Right 1181027150 22:20132765-20132787 TCTTCACCCAAGATACAGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 117
1181027145_1181027155 16 Left 1181027145 22:20132749-20132771 CCCTCCAGCCTCAACTTCTTCAC 0: 1
1: 0
2: 3
3: 43
4: 465
Right 1181027155 22:20132788-20132810 CTTAGGACCAGAGAGGCATGCGG 0: 1
1: 0
2: 1
3: 16
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181027145 Original CRISPR GTGAAGAAGTTGAGGCTGGA GGG (reversed) Intronic
900567316 1:3339897-3339919 GTGCAGCAGCTGAGGTTGGAAGG + Intronic
900907523 1:5571372-5571394 TTAGACAAGTTGAGGCTGGATGG + Intergenic
902180331 1:14683483-14683505 GGGAAGCAGTGGAGGCTGGAAGG - Intronic
902315884 1:15617889-15617911 GTGAAGAATTGGGGGCTGGGGGG + Intronic
902480989 1:16711512-16711534 TCCAAGAAGTTGAGGCTGCAGGG + Intergenic
903183264 1:21615703-21615725 CTGAAGAAGTGCAGACTGGAGGG - Intronic
903186687 1:21633266-21633288 GGTATGAGGTTGAGGCTGGAGGG - Intronic
904483140 1:30806611-30806633 GTGGGGCAGCTGAGGCTGGACGG - Intergenic
905800596 1:40839894-40839916 GTGAAGAAGTGGGGTGTGGAGGG - Exonic
906861795 1:49368776-49368798 TAGAAGAAATTGAGGCTGGCCGG + Intronic
907277523 1:53325529-53325551 GTGAGGAAACTGAGGCAGGAGGG + Intronic
907454716 1:54567931-54567953 GGGAAGAACTGGAGGCTGTAGGG - Intronic
907703056 1:56808191-56808213 ATGAAGAAATTAAAGCTGGAGGG + Intronic
907841137 1:58158546-58158568 GGGAAGAAGGTGAGACTCGAAGG + Intronic
907968658 1:59358905-59358927 ATGAAGAAATTGAGGATGGAGGG + Intronic
908135168 1:61124694-61124716 GTGATAAAGTTGGGGCCGGATGG + Intronic
908366242 1:63426430-63426452 GAGAAGAGGTTGAGGATGTAGGG + Intronic
909563298 1:77028124-77028146 TTAAAGAATTTGAGGCTGCAAGG - Intronic
910061470 1:83098088-83098110 GTCAAGAAGCAGAGGTTGGATGG + Intergenic
910083741 1:83373132-83373154 GTAAAGGAGTTCAGGCAGGAAGG + Intergenic
910150535 1:84137790-84137812 GTAAATAAGTTGATGGTGGATGG + Intronic
910307126 1:85778177-85778199 CTGAGGAAGTTGAGGCTATAGGG - Intronic
911264516 1:95727262-95727284 GTGCTGATGTTAAGGCTGGACGG + Intergenic
911857561 1:102899810-102899832 GAGAATAAGGTGAGGCAGGAGGG + Intronic
911874868 1:103147988-103148010 GTGAAGAGGTTGAGGATGAAGGG - Intergenic
912843456 1:113059389-113059411 GTGAACAGAGTGAGGCTGGAGGG + Intergenic
912904833 1:113693357-113693379 GTAAAGGAGGTGAAGCTGGAAGG + Intergenic
914493182 1:148167264-148167286 GTGAGGAAGTTGGGGGTGGTGGG + Intergenic
915533177 1:156516191-156516213 GTGAGGAAGTTGAGGCCACATGG - Intergenic
915841085 1:159213568-159213590 GGGAAGAAGTGGAGGGAGGAAGG + Intergenic
916323704 1:163533847-163533869 GTTAAGAAGGTGGGGCTGGGTGG - Intergenic
916647144 1:166797364-166797386 GTGAAGGAATTAAGGCAGGAGGG - Intergenic
917639976 1:176973945-176973967 GTGAAGAAGTTGAGGATCTGTGG - Intronic
918107418 1:181426504-181426526 GTGAAGGGGTTGAGACAGGAAGG - Intronic
918107532 1:181426999-181427021 GTGAAGAAGCTGAGGTGGGAAGG - Intronic
918123063 1:181556703-181556725 GGGAAGAAGTTGGGGCAGGAGGG + Intronic
918438720 1:184544276-184544298 GTTTAGAAGTTGAGGCAGGGTGG + Intronic
919055870 1:192569374-192569396 GAGAAGAAACTGAGGCTTGAGGG - Intergenic
919137523 1:193529449-193529471 GGGAAGAAGTTGAGGTTGTTAGG - Intergenic
919588740 1:199472348-199472370 GTGAATGAGTTGAAGCTGAAAGG + Intergenic
919640123 1:200038840-200038862 GTGAAGAGGTTGGGGCAGGCCGG + Intronic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
919944240 1:202308113-202308135 GTGAAGCGGGTGGGGCTGGATGG - Intronic
921209828 1:212885294-212885316 GAGAAGAAGTCAATGCTGGAAGG + Exonic
922042089 1:221906493-221906515 GAGGATAACTTGAGGCTGGAAGG + Intergenic
923087663 1:230713716-230713738 GTGCAGGAATTGGGGCTGGAGGG - Intronic
923590154 1:235310776-235310798 CTCAGGAAGTTGAGGCTGGGAGG - Intronic
923981446 1:239328522-239328544 GTGAAGACCTTGAGGCAGGGAGG - Intergenic
924651269 1:245929593-245929615 GTGAAGAAGTTGAGGACGGTGGG - Intronic
1062908152 10:1193053-1193075 GTGGAGGTGTTGAGGGTGGAAGG + Intronic
1063913074 10:10852427-10852449 GTGCTGGAGTTGGGGCTGGAAGG + Intergenic
1064609251 10:17080015-17080037 GAGCAGAAGCTGAGGCAGGAAGG - Intronic
1066430019 10:35342739-35342761 GTGAAGAAATTGAGCCTTAAAGG + Intronic
1066462156 10:35621586-35621608 GGGAAGAACGTGTGGCTGGAGGG + Intergenic
1067541235 10:47155408-47155430 GAGAATAACTTGAGCCTGGAAGG + Intergenic
1068698457 10:59994746-59994768 ATGAAGAAATTGAGGCTCAAAGG + Intergenic
1070287208 10:75092786-75092808 GTGCAGAATCTGAGGCTGCAGGG - Intergenic
1070786932 10:79167398-79167420 GTGAAGAAACTGAGGCCTGAGGG + Intronic
1071671548 10:87613622-87613644 GTTGGGAAGCTGAGGCTGGAGGG + Intergenic
1072005939 10:91247571-91247593 ATGAAGGAGATGAGGCAGGAAGG + Intronic
1072160557 10:92762290-92762312 TTGAAGAAGTTGAAGCAGGAAGG - Intergenic
1073446084 10:103581182-103581204 GTGAGAAATTTGAGGCTGGGAGG + Intronic
1073652432 10:105375848-105375870 GAGTAGAAGTGGAGGTTGGAAGG - Intergenic
1074769973 10:116726835-116726857 GAGAAATAGTTAAGGCTGGAGGG - Intronic
1075070169 10:119315117-119315139 GTGAAGAAACTGAGGCCAGAGGG + Intronic
1075126634 10:119705768-119705790 CTCAGGAAGTTGAGGCTGGAGGG - Intergenic
1075191963 10:120317399-120317421 GTGGAAAAGTTGAGGGTGAAGGG - Intergenic
1075343671 10:121666762-121666784 GTGAGGAATCTGAGGCTAGAAGG - Intergenic
1075564774 10:123495235-123495257 GTGAAGAAGGTGGTGCTGGTTGG + Intergenic
1075672175 10:124270303-124270325 TTGGGGAAGGTGAGGCTGGAGGG - Intergenic
1076237829 10:128879536-128879558 AAGAGGAAGGTGAGGCTGGAAGG + Intergenic
1076693591 10:132236401-132236423 ATGAGGAAGCTGAGGCTGGGTGG + Intronic
1077524612 11:3056881-3056903 GTGAGGAAACTGAGGCTGGGTGG + Intronic
1077741617 11:4852422-4852444 GTGAAGAACTGTAGGCTGGGAGG + Intronic
1077837793 11:5939307-5939329 ATGAGGATGATGAGGCTGGAAGG + Intergenic
1078040247 11:7854941-7854963 ATGAAAAAGTTAAGGCTAGACGG - Intergenic
1078151616 11:8764475-8764497 ATGAAGAAGCTGAGGCTGAAAGG + Intronic
1078195970 11:9137446-9137468 GTGCAGAAGCTGAGGCAGGCAGG + Intronic
1078745970 11:14114603-14114625 GTGAAGAAATAGAGGCTGGATGG - Intronic
1078901361 11:15645453-15645475 GTGCAGAAGTAGAGCCTGCAGGG - Intergenic
1079421987 11:20302102-20302124 ATGAAGATGTATAGGCTGGAGGG + Intergenic
1079485605 11:20933187-20933209 GTGGAGGTGTTGAGGCTGGCAGG + Intronic
1081698786 11:45138490-45138512 CCTAAGAAGTTGAGGCTGCAGGG + Intronic
1081967885 11:47180441-47180463 CTGAAGGAGGTGAGGCTGGGTGG - Exonic
1081983851 11:47287497-47287519 GTGAATCACTTGAGCCTGGATGG - Intronic
1082837590 11:57663003-57663025 CTGTACAAGATGAGGCTGGAGGG + Intergenic
1083371993 11:62189691-62189713 GTGAAGATGGTGGGGATGGAAGG + Intergenic
1084686340 11:70698041-70698063 GTGGGGAGGTTGAGGCTGGGGGG - Intronic
1084942178 11:72618681-72618703 GGGAAGGAGATGAGACTGGATGG - Intronic
1084969711 11:72764500-72764522 GTGAAGAAACTGAGGCAGGCCGG + Intronic
1085473253 11:76771538-76771560 GTGGAGAGGTGGAGGCTGGAAGG + Intergenic
1086232669 11:84589109-84589131 GTGGAGAGGTTGTGGCTGAAGGG + Intronic
1086747945 11:90453727-90453749 GTGAAGCACTGGGGGCTGGATGG + Intergenic
1088866783 11:113855261-113855283 GTGAAGATGTTAAGGCTGAAGGG - Intronic
1089430542 11:118420626-118420648 CTGAAGGAGTTCATGCTGGATGG - Intronic
1089470255 11:118715024-118715046 GTGTTGATGTTGATGCTGGAGGG + Intergenic
1089637093 11:119821923-119821945 GAGATGAAGTTGATGCTGCATGG - Intergenic
1091135681 11:133186849-133186871 GTGAGGGAACTGAGGCTGGAGGG + Intronic
1091679414 12:2516140-2516162 ATAAAGACGTGGAGGCTGGAAGG + Intronic
1091706601 12:2697656-2697678 GTGAAGTCGTGGAGCCTGGAGGG - Intronic
1092260697 12:6951930-6951952 GTGCAGGAGTAGAGGCAGGAGGG - Intronic
1093047171 12:14460711-14460733 CTGTAGAAGCTGAGGCTGGGAGG - Exonic
1095318922 12:40801676-40801698 GAGAACAAGATGAGGCTAGAGGG + Intronic
1096036306 12:48474116-48474138 GTAAAGAAGTTGAAGTTTGAGGG - Intergenic
1096079040 12:48821785-48821807 GAGAACAAAATGAGGCTGGATGG - Intronic
1096537020 12:52281422-52281444 GTGATGGGGTTGAGGCTGCATGG + Intronic
1097562510 12:61224803-61224825 GAGAAGGATTTAAGGCTGGAGGG - Intergenic
1098420716 12:70294209-70294231 GTGAAGAAGGAAAGGTTGGAGGG - Intronic
1098521655 12:71440261-71440283 GTGAAGACGCTGAGGTTGGAAGG - Exonic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099225994 12:79969842-79969864 TTGTGGAAGTTGAGACTGGAAGG + Intergenic
1099886182 12:88534134-88534156 ATGAAGAAACTGAGGCTAGAAGG + Intronic
1099887039 12:88544308-88544330 ATGAAGAAACTGAGGCTAGAAGG + Intronic
1101661092 12:106766264-106766286 GTTTAGAACTTGAGGGTGGAAGG - Intronic
1101950272 12:109169276-109169298 GTGAAGAGCTTGGGGCAGGAAGG - Intronic
1103722353 12:122981563-122981585 AGGGAGAAGGTGAGGCTGGAAGG - Exonic
1103859664 12:124002300-124002322 GTGCAGGAGGTGAGGTTGGAAGG + Intronic
1106843548 13:33712293-33712315 GGTTAGAAGTTGAGGCTGGAGGG - Intergenic
1107039955 13:35937804-35937826 TTGAAGAAGTGGAGGCTTCAAGG + Intronic
1107814096 13:44228848-44228870 GTGAAGTAAAAGAGGCTGGAAGG - Intergenic
1108142635 13:47440982-47441004 CTCAGGAGGTTGAGGCTGGAAGG - Intergenic
1108521653 13:51251800-51251822 GTGAAGAAGTCCTGGCTGCAGGG - Exonic
1108875111 13:55037724-55037746 GTGAGGAAGTTGAGGAAAGATGG + Intergenic
1108922081 13:55688591-55688613 CTGGGGAAGTTGAGGCTGCAGGG - Intergenic
1110475339 13:75907159-75907181 GTGAAGTAGATGAGGCTTCATGG + Intergenic
1110568246 13:76977530-76977552 GTGAAGAAGGTGTGGCTCAAAGG - Intergenic
1111262687 13:85762259-85762281 GTAAAGCCTTTGAGGCTGGAAGG - Intergenic
1111864163 13:93747148-93747170 GTAAAGAAGTTGAGGCCAAAGGG + Intronic
1111957054 13:94770825-94770847 GTGAAGAAGGTGGGGAGGGAGGG + Intergenic
1112439105 13:99412685-99412707 CTGAACAATTTGAGGCTGGCTGG + Intergenic
1113097178 13:106678320-106678342 CTGATGAAGATGAGGCAGGATGG + Intergenic
1113692371 13:112320325-112320347 GTGGGTGAGTTGAGGCTGGAGGG - Intergenic
1113759890 13:112840105-112840127 GTGGGGAGGCTGAGGCTGGAGGG - Intronic
1113759900 13:112840137-112840159 GTGGGGAGGCTGAGGCTGGAGGG - Intronic
1113759923 13:112840201-112840223 GTGGGGAGGCTGAGGCTGGACGG - Intronic
1113759932 13:112840233-112840255 GTGGGGAGGCTGAGGCTGGAGGG - Intronic
1113759942 13:112840265-112840287 GTGGGGAGGCTGAGGCTGGAGGG - Intronic
1113759952 13:112840297-112840319 GTGGGGAGGCTGAGGCTGGAGGG - Intronic
1113760009 13:112840489-112840511 GTGGGGAGGCTGAGGCTGGAGGG - Intronic
1114746384 14:25152603-25152625 GTGAACAGGTGGAGGCTAGAAGG - Intergenic
1114750104 14:25194517-25194539 GTGTAGAAGTTTAGGATAGAGGG + Intergenic
1116109421 14:40558249-40558271 GTGAAGAAAAGGAGGGTGGAAGG - Intergenic
1116978278 14:51140371-51140393 GAGAAGAAAAAGAGGCTGGAAGG + Intergenic
1117287171 14:54297438-54297460 ATGTAGAAATTGAGGGTGGAGGG - Intergenic
1117351243 14:54883881-54883903 CTAAAGAAGGTGAGGCAGGAAGG + Intronic
1117671948 14:58117057-58117079 CTGGAGAAGTGGAGGCAGGAGGG - Intronic
1118177864 14:63460595-63460617 GTGAACAAGTTTAGGCAGGTAGG + Intronic
1118349238 14:64961595-64961617 GTTAAGATGATGAGGCTGGAGGG - Intronic
1118373112 14:65154303-65154325 GGGAGGAAAATGAGGCTGGAAGG + Intergenic
1119483728 14:74975222-74975244 CTGAAGAGATAGAGGCTGGAGGG + Intergenic
1120242603 14:81966647-81966669 GTGAAGATTTTGAGGGTAGAGGG + Intergenic
1120944282 14:89979397-89979419 GTGAATCAGTTGAAGCTGGGAGG - Intronic
1121246292 14:92463189-92463211 CTGAAGAAGATGGGGGTGGATGG - Intronic
1121597777 14:95178980-95179002 ATGAGAAGGTTGAGGCTGGAAGG - Intergenic
1122308575 14:100780653-100780675 GTAAAGACTTTGAGGTTGGATGG - Intergenic
1125152803 15:36552340-36552362 GAGAACCAGTTGAGGCAGGAAGG + Intergenic
1125466549 15:39958787-39958809 GTGTAGATGTTGGGGCAGGAGGG - Intronic
1127203381 15:56684033-56684055 GTGCAGAAGCTGAGGCAAGAAGG + Intronic
1127566773 15:60196962-60196984 GTGGATCACTTGAGGCTGGAGGG + Intergenic
1127820028 15:62646694-62646716 GTGAAGAAATTGAGGCAGAGTGG + Intronic
1128502546 15:68237377-68237399 CTGAGGAAGCTGAAGCTGGAGGG + Intronic
1128690259 15:69719312-69719334 ATGAGCAAGTGGAGGCTGGATGG + Intergenic
1128709532 15:69861317-69861339 GTGGGGAAACTGAGGCTGGAAGG + Intergenic
1128891760 15:71337908-71337930 GGGAAGCGGCTGAGGCTGGAAGG - Intronic
1129011752 15:72424855-72424877 GTGGCAAAGATGAGGCTGGAAGG + Intergenic
1129668635 15:77594114-77594136 GTGAATAAGTAGAGGCTGGACGG + Intergenic
1129694706 15:77734136-77734158 TTGAAGTAGTGGGGGCTGGAGGG - Intronic
1130624874 15:85503910-85503932 GTGAGGGAGATGATGCTGGAGGG + Intronic
1131435078 15:92415924-92415946 GAAAAGAAGATGAGGCTGAAGGG + Intronic
1131663391 15:94543066-94543088 GTGAAGAAGTGAAGGAAGGAAGG + Intergenic
1132299270 15:100766368-100766390 GTGAAGAATTAGGAGCTGGACGG - Intergenic
1132549318 16:547844-547866 GTGGTGAAGTCGGGGCTGGAGGG - Exonic
1132714005 16:1281734-1281756 GTGGGGAAACTGAGGCTGGAGGG - Intergenic
1132837353 16:1960727-1960749 GTGAGGAAGCTGAGGCCGTAAGG + Intronic
1132981464 16:2740438-2740460 GTGAGGAAGGTGAGGCTGGAGGG - Intergenic
1134249388 16:12563742-12563764 GTGGAGAAGTTGTGGCTGTTGGG - Intronic
1134267055 16:12701569-12701591 GTGAACCAGAAGAGGCTGGAGGG + Intronic
1134398354 16:13886218-13886240 ATGAAGAAGCTGAGGCTTGATGG + Intergenic
1136099161 16:27980584-27980606 ATGAAGAAACTGAGGCTGGCTGG + Intronic
1137721590 16:50630609-50630631 TGGAAGGAGGTGAGGCTGGAGGG + Intronic
1139519767 16:67474422-67474444 CAGAAGAAGGTGAGGCTAGAAGG - Intronic
1139661068 16:68421231-68421253 GTGAAGCAGATGAGGGAGGATGG - Intronic
1140115677 16:72039413-72039435 TTGGAGAAGCTGCGGCTGGAGGG + Intergenic
1140212887 16:72984548-72984570 CTCAAGAGGTTGAGGCTGCAAGG + Intronic
1140265216 16:73414744-73414766 GGGAAGAACTTGAGCCTGGGAGG + Intergenic
1142431848 16:90032907-90032929 GTGAAGAACCTGCGGCTGGTAGG + Exonic
1143399769 17:6636749-6636771 GGGAAGAAGTTGGGGCTGTGTGG - Intronic
1143887919 17:10079414-10079436 GTGTTGAAGTTAATGCTGGAGGG - Intronic
1145872275 17:28284839-28284861 GCCAGGAAGTTGAGGCTGCAGGG - Intergenic
1147154587 17:38537423-38537445 TTGGAGAGGTTGAGGCTGCAGGG + Intronic
1147638416 17:41978491-41978513 GTGAGGAGGTTGGGGTTGGAGGG - Intronic
1147677246 17:42216135-42216157 GAGAAGAACTTGAGGCTCGTGGG - Intronic
1148008360 17:44453599-44453621 GCCATGAAGTTGAGGCTGCAGGG - Intronic
1148047304 17:44751988-44752010 GTAAAGTAGTTAGGGCTGGAGGG - Exonic
1148795981 17:50196939-50196961 GGGAAGAGGTTGGGACTGGATGG + Intronic
1149000472 17:51752364-51752386 ATGGAGAAGTTGAAGCTGCAGGG + Intronic
1149448861 17:56733905-56733927 ATGAATGAGTTGGGGCTGGATGG - Intergenic
1150976203 17:70089984-70090006 GTGAGACAGTTGAGGCTGGATGG - Intronic
1150989429 17:70238733-70238755 GCAAAGAAGCTGAGGCTGAAAGG + Intergenic
1151334642 17:73432656-73432678 GTGAAGGAGGTAGGGCTGGAGGG + Intronic
1151339912 17:73464570-73464592 TGGAAGATGGTGAGGCTGGAAGG - Intronic
1151354316 17:73549556-73549578 GGGAAGTAGATGGGGCTGGATGG + Intronic
1151961496 17:77408197-77408219 ATCAAGAAATTGAGGCTGGGAGG - Intronic
1152605611 17:81288186-81288208 GGGAGGAAGTGGAGGCTGGGAGG + Intronic
1152769750 17:82160109-82160131 GAGAAGAAGCAGAGGCTGCAGGG + Intronic
1153300151 18:3585184-3585206 GGGAAGAACCTGAGGCTGGCTGG - Intronic
1153342410 18:3989027-3989049 GTGCAGCAGTGGAGGCAGGAGGG - Intronic
1153500181 18:5741074-5741096 GTGAGGAAAAGGAGGCTGGAAGG + Intergenic
1154303693 18:13216364-13216386 ATGACGAAGTTGAGGCTAGAAGG - Intergenic
1155012363 18:21792413-21792435 GGGCAGGAGTTGGGGCTGGATGG - Intronic
1155693318 18:28653236-28653258 GTGAGGAAGATAAGGCTGCAAGG + Intergenic
1156646715 18:39171663-39171685 GTGAAGGAGTAGAAGGTGGAGGG + Intergenic
1160319250 18:77875070-77875092 GTGGAGAGGTGGAGGCTGGGCGG - Intergenic
1161506846 19:4648661-4648683 CTGAAGAAGTTGATTCCGGACGG - Intronic
1161760125 19:6164968-6164990 GTGAAGAAGCTGAGGCTCAGGGG - Intronic
1161840594 19:6678009-6678031 ATGATGTAGCTGAGGCTGGAGGG + Exonic
1162529900 19:11229724-11229746 GAGAAGAACGTGAGGCTGGGCGG + Intronic
1162992847 19:14314596-14314618 GTGCAGAAGGGGAGGCTGGGTGG + Intergenic
1163246447 19:16097927-16097949 TTGCAGAAGTTCAGGATGGACGG - Intronic
1163265556 19:16218542-16218564 GGGAAGACATAGAGGCTGGATGG - Intronic
1163315832 19:16539927-16539949 CTCAAGAGGCTGAGGCTGGAGGG - Intronic
1163357885 19:16826306-16826328 GTGAAGAAGCTCAGGCTGCAAGG + Intergenic
1163403410 19:17108088-17108110 GTGCAGGCGTGGAGGCTGGAGGG - Intronic
1164799978 19:31068249-31068271 GTGACCTAGTTGGGGCTGGACGG + Intergenic
1165212483 19:34247035-34247057 GAGAAGAGGTTGAAGCTGGGAGG - Intergenic
1166778147 19:45324628-45324650 AGGAAGAAGATGAGGTTGGAGGG + Intergenic
1166855393 19:45780644-45780666 TGGAAGAAGTGGAGGCAGGATGG + Intronic
1167113884 19:47477512-47477534 GGGAATATGTTGAGGCTGGGGGG - Intronic
1168229197 19:55018166-55018188 GTGAAGGTGTTTAGTCTGGAAGG + Intronic
1168649939 19:58086432-58086454 AAGAAGAAGGCGAGGCTGGAAGG + Intronic
1202715026 1_KI270714v1_random:37417-37439 TCCAAGAAGTTGAGGCTGCAGGG + Intergenic
925121810 2:1424364-1424386 GTGTTGATGTTGATGCTGGAGGG + Intronic
925233283 2:2254838-2254860 GGGAAGTAGTTGGGGCTGTATGG - Intronic
926001867 2:9339811-9339833 GAGAGGCAGGTGAGGCTGGAAGG - Intronic
926439141 2:12869668-12869690 GTGAAGAGGTAGAGGCAGAAAGG + Intergenic
926751308 2:16200823-16200845 GTGAAGAAAATGTGGCTGGGTGG - Intergenic
928014451 2:27642233-27642255 CTGCAGAAGTTTAGACTGGAGGG - Intronic
928262961 2:29784373-29784395 GTGAAGAAATTGAGGTTGAGTGG + Intronic
928735205 2:34280259-34280281 TTGAAGGAATTCAGGCTGGAAGG - Intergenic
929288201 2:40159982-40160004 CTGTAGAAGATGAGCCTGGAGGG + Intronic
929599952 2:43198738-43198760 GTGAGGCTGATGAGGCTGGATGG - Intergenic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
929983106 2:46699218-46699240 GTGAAGAAGGGGAGGCGGCAGGG + Intronic
931831706 2:66059106-66059128 GTGAAGAAGGTGAGGGTCCAGGG - Intergenic
932823654 2:74921701-74921723 GTGAAGAAGTGGAGAAAGGAGGG - Intergenic
934533016 2:95107564-95107586 GGGAAGAGGTTGAAACTGGAGGG - Intronic
935085259 2:99838565-99838587 TTGAAGAAGTGGAGGCTGCTGGG - Intronic
935581081 2:104756347-104756369 GTGAGGAAGCTGAGACTGGAAGG + Intergenic
935839255 2:107091234-107091256 TTGTAGCATTTGAGGCTGGATGG + Intergenic
935904055 2:107824347-107824369 CTGAACAAAATGAGGCTGGAAGG - Intergenic
937368296 2:121280928-121280950 ATGAAGACACTGAGGCTGGAGGG + Intronic
938066355 2:128283962-128283984 GTCAAGAAATGGAGGCTGGGTGG + Intronic
938132727 2:128731495-128731517 GTGAAGAAGGTGAGGCTGACAGG + Intergenic
938613287 2:132971372-132971394 GGGAGGGAGATGAGGCTGGATGG + Intronic
938686654 2:133744354-133744376 TTGAAGAAATTGAGGCTTAAGGG + Intergenic
939638665 2:144612900-144612922 GCCAGGAAGTTGAGGCTGAAGGG + Intergenic
940308579 2:152252974-152252996 GTGACAGAGTTGAGGCAGGAGGG - Intergenic
941431652 2:165421400-165421422 ATGAAGAAGCTGAAGCTGCAAGG - Intergenic
941485378 2:166073569-166073591 GTGAAGAAGTTGAAGCTGTCAGG + Exonic
941641807 2:167996907-167996929 GTCTAGACTTTGAGGCTGGATGG + Intronic
941784524 2:169483042-169483064 GAGAAGAAGTTTAGGAGGGAGGG + Intronic
941800113 2:169650404-169650426 TTGCAGAAGCTGAGGCTGAATGG - Exonic
942168412 2:173265227-173265249 CTGAGGAAGCTGAGGCTGGGAGG + Intronic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
943665829 2:190607258-190607280 GTCAGAAAGATGAGGCTGGAAGG + Intergenic
943727215 2:191264917-191264939 GTGAGGAAACTGAGGCTTGAAGG + Intronic
944819326 2:203414003-203414025 CTGAAGAGGATGAGGCAGGAAGG - Intronic
946276695 2:218636975-218636997 TTGAGGAAGTTGGGGATGGAGGG - Exonic
946559143 2:220892801-220892823 GTGAAGAATTGGGGGCTGGCTGG - Intergenic
946785438 2:223238767-223238789 CTGAAGATGTTGAGCTTGGAGGG + Intergenic
946877090 2:224140112-224140134 GTGACCAACTTGAGGCTGGAGGG - Intergenic
947587031 2:231362629-231362651 GTGAGGAAGAAGAGGATGGAAGG + Intronic
947760414 2:232599956-232599978 GTGAAGAAGCAGAGCCCGGAAGG + Intergenic
948676707 2:239601192-239601214 GTGAGGAAACTGAGGCTGGTAGG - Intergenic
1169800059 20:9505665-9505687 GTGATGAAGAGGAGGCTGGGAGG + Intergenic
1170414072 20:16121535-16121557 GTGAAGAAGGTGAGGCTTTGGGG - Intergenic
1170605365 20:17871685-17871707 GTGAAGATTTGGAGGCTGGGAGG + Intergenic
1170825461 20:19790801-19790823 GTGAAGTGCTGGAGGCTGGAAGG - Intergenic
1171037403 20:21726817-21726839 ATGCAGAACTTGAGGCTTGAAGG - Intergenic
1171046604 20:21813988-21814010 GGGAATGAGATGAGGCTGGAGGG - Intergenic
1171154955 20:22863389-22863411 ATGAAGAATGTGAGGGTGGAAGG - Intergenic
1172204590 20:33153894-33153916 GTGAAGAATATGTGGATGGATGG + Intergenic
1172463547 20:35137938-35137960 GGGTGGAAGTAGAGGCTGGATGG - Exonic
1172619384 20:36309062-36309084 GTGAAGACCCTGAAGCTGGAGGG - Intronic
1172623085 20:36332258-36332280 GTGAAGAGGATGAGGCTCAAAGG - Intronic
1172649062 20:36490349-36490371 GGGAAGGATTTGAGGCTGGGTGG + Intronic
1172754962 20:37277063-37277085 CTGAAGAACTTGAGATTGGAGGG + Intergenic
1173563016 20:44019824-44019846 GTGAAGAAAGTGAGGCCGGAAGG - Intronic
1173644995 20:44627707-44627729 GTGATGGAGTTAAGGCTGGCAGG + Intronic
1173704041 20:45097082-45097104 ATGAAGAAGCTGAGGTTGAAGGG - Intronic
1174015674 20:47486192-47486214 CTCAAGAGGCTGAGGCTGGAGGG + Intergenic
1174425600 20:50429909-50429931 GAGAAGCAGTAGAGGGTGGAAGG + Intergenic
1174830792 20:53810547-53810569 GTGAAGGAGATGAGGGTGGGAGG + Intergenic
1175889645 20:62310526-62310548 GTGAAGAGACTGAGGCTGCACGG - Exonic
1175912505 20:62411514-62411536 GTGCAGAAATTGAGGCTGAGAGG - Intronic
1175934848 20:62509858-62509880 GTGGAGCAGTGGAGGATGGAGGG - Intergenic
1175934883 20:62509970-62509992 GTGAAGGGGTGGAGGGTGGAGGG - Intergenic
1175934976 20:62510215-62510237 GTGAAGGTATGGAGGCTGGAAGG - Intergenic
1175935063 20:62510451-62510473 GTGGAGAGGTGGAGGATGGAGGG - Intergenic
1177666664 21:24168323-24168345 GTGAACAAGATGAGGCTAGTTGG + Intergenic
1178282026 21:31291910-31291932 CTGAAGAAGGAGAGTCTGGAAGG - Intronic
1178525364 21:33324442-33324464 GGGAACCAGATGAGGCTGGAAGG - Intergenic
1179876888 21:44273152-44273174 GGGAAGATGTGGAGGGTGGAAGG + Intergenic
1180869315 22:19137487-19137509 GTGAACAAGCTGTGACTGGAGGG - Intronic
1181027145 22:20132749-20132771 GTGAAGAAGTTGAGGCTGGAGGG - Intronic
1181158244 22:20939083-20939105 GTGTCCAAGTTGAGACTGGAGGG - Intronic
1181678637 22:24475323-24475345 GTAAAAAAGTTGAGGGGGGAAGG - Intergenic
1182049643 22:27302956-27302978 TGGAACAAGTTGAGGATGGAGGG - Intergenic
1182139276 22:27938831-27938853 CTGAAGAGGTTGAGGCAGGAGGG + Intergenic
1182151246 22:28028599-28028621 GTGAAGGACTTGAGGTAGGAAGG + Intronic
1182322739 22:29489106-29489128 GTGAAGAAGAGGAGGCAGAAGGG + Exonic
1182480938 22:30608283-30608305 GTGAAGAAGTCGAGGGTTGGAGG + Intronic
1182522418 22:30891999-30892021 GTGAAGAAGCAGCAGCTGGAGGG + Intronic
1183760122 22:39808640-39808662 GGGAAAAAGTTTAGGTTGGATGG + Intronic
1183874295 22:40765807-40765829 GTGAAGTAGTTGAAGCTTAAAGG - Intergenic
1184533814 22:45072881-45072903 GTGAGAAACCTGAGGCTGGAAGG + Intergenic
1184896565 22:47410666-47410688 AAGAACAAGATGAGGCTGGATGG + Intergenic
949764944 3:7516073-7516095 GGGAGGATCTTGAGGCTGGAAGG + Intronic
950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG + Exonic
950627178 3:14255981-14256003 ATGGAGAAATTGAGGCTGGAGGG - Intergenic
950678646 3:14569715-14569737 GCGCAGAGGCTGAGGCTGGAAGG - Intergenic
952060511 3:29503310-29503332 GGTAAGAATTAGAGGCTGGAGGG - Intronic
952665867 3:35903210-35903232 GTGAAAAAGTTTAGGCTTCAGGG - Intergenic
953744676 3:45565227-45565249 GTGATGAAAATGAGGGTGGATGG + Intronic
954001970 3:47565036-47565058 ATGAAGGAGTTGAGGGTGGGAGG - Intronic
954193691 3:48983293-48983315 GTGAGGAAGATGTGGCTGCAAGG + Exonic
954672640 3:52298987-52299009 GCGAAGGAGTGGAGGCTGGAGGG + Intergenic
955629526 3:60957639-60957661 GTGAAGAAATTGACACAGGAGGG - Intronic
956227322 3:66974513-66974535 GGGAAGGAGATGAGGCAGGAAGG + Intergenic
956368195 3:68529235-68529257 GTGAAGAAGGGCAGGGTGGAGGG - Intronic
957459115 3:80494517-80494539 TGGAAGAAGTTGGGGGTGGAGGG - Intergenic
958476432 3:94589556-94589578 GTGAAGAAATTGAGGATGCAGGG + Intergenic
960169344 3:114440248-114440270 GTGAAGTAGATGAGGATAGATGG + Intronic
960418309 3:117412448-117412470 GTGAGGATGCTGATGCTGGATGG + Intergenic
960737846 3:120799973-120799995 ATGAAGAAATTGAGGCTCAAAGG + Intergenic
960918000 3:122716763-122716785 TTGAGGAAGTTAAGTCTGGAGGG - Intronic
961941970 3:130647185-130647207 CTGAAGAAGCCTAGGCTGGATGG - Intronic
962055855 3:131870877-131870899 CTGAAGAAGAGAAGGCTGGAAGG + Intronic
963005488 3:140723105-140723127 GTGAAGAAGTTGGGAGAGGAAGG - Intergenic
963419383 3:145040788-145040810 GAGAAGAAGGTGAGGCTGCTGGG + Intergenic
964389815 3:156185330-156185352 TTGGAGATGGTGAGGCTGGAAGG - Intronic
966462952 3:180197855-180197877 GGGAAGAAGTTGAGACCGTAAGG + Intergenic
966855832 3:184193357-184193379 ATGTAGAAGTTGGGGCTGGAAGG - Exonic
967472895 3:189883531-189883553 GTTAAATATTTGAGGCTGGAGGG + Intronic
967546153 3:190731262-190731284 CTGAAGGAGGTGAGGCTGTAGGG + Intergenic
968074711 3:195810051-195810073 GTGAGGACGTGGAGGCCGGAAGG - Intronic
968914023 4:3489378-3489400 GTGAGGAAGATGAGGAAGGAGGG + Intronic
969066187 4:4483453-4483475 GTTAGTAAGTTGGGGCTGGAAGG - Intronic
969462695 4:7337149-7337171 TTGCAGAAGGTGGGGCTGGAAGG + Intronic
969685410 4:8671266-8671288 AAGAAGAAGGTGAGGGTGGAAGG + Intergenic
970426203 4:15948466-15948488 GAGGGAAAGTTGAGGCTGGATGG + Intergenic
970837786 4:20431688-20431710 GAAAAGAAGTTAAGACTGGAAGG + Intronic
971333141 4:25699066-25699088 GTGAAGAAGTCCAGGCCAGAAGG - Intergenic
971455401 4:26839624-26839646 GTGATGAAGTTGAGCCAGCAAGG - Intergenic
971714088 4:30153419-30153441 GTGAAGAAGTGCATGCTGAATGG + Intergenic
972539136 4:40023944-40023966 GTGAAGAAGATGAAGTAGGAAGG + Intergenic
973876010 4:55219344-55219366 GTGAAGAAATTAAGGCTTAAAGG + Intergenic
974397733 4:61360970-61360992 GTGAAGAAACTGAGGCTAGGAGG + Intronic
974915788 4:68176636-68176658 GAGTAGAAGTAGAGCCTGGAAGG - Intergenic
975273249 4:72463990-72464012 CTTAAGAAGTTTAGACTGGAGGG - Intronic
977343589 4:95791181-95791203 GCAAAGAAGCTCAGGCTGGATGG + Intergenic
978514128 4:109553276-109553298 GTGAAGAAGATGATGATGAAGGG - Intergenic
978567776 4:110102582-110102604 CTGGAGAGGTTGAGGCTGTAGGG + Intronic
980066247 4:128191876-128191898 ATGAAGAAGCTGAGTCTGGGAGG + Intronic
980092857 4:128460327-128460349 GTGAAGAAACTGAGGCTTGGAGG + Intergenic
980450170 4:132959417-132959439 GTCATGAAGCTGACGCTGGAAGG + Intergenic
981216878 4:142179960-142179982 GAGAAGATTTTGAGGTTGGAAGG - Intronic
981538710 4:145826228-145826250 GTGACGAAACTGAGGCTAGAGGG - Intronic
982346006 4:154360314-154360336 AGGAAGAAATTGAGGCTGGAAGG - Intronic
983695471 4:170523785-170523807 GTGAGGAAATTGAGCCAGGAAGG - Intergenic
983900915 4:173133071-173133093 GTTAAGAAAATGAGGCTGTAAGG - Intergenic
984976405 4:185234384-185234406 GTTAAAAAGTTTAGGCTGGCCGG + Intronic
985785301 5:1890147-1890169 GTGGAGAAGATGAGGCTGTGGGG - Intergenic
986123724 5:4866764-4866786 GTGACGAGGTCGAGGCTGTAAGG + Intergenic
986245873 5:6006226-6006248 CTCAAGAATTTGAGGCTGCAGGG + Intergenic
988365295 5:30290581-30290603 AGGAAGAGGTTGAGGTTGGAGGG - Intergenic
989959622 5:50395931-50395953 GTAAAGAATTTTAGGCTGCATGG - Intergenic
990951876 5:61306417-61306439 TTTTAGAAGTTGAGGGTGGAAGG + Intergenic
990989091 5:61667956-61667978 GTTGAGAAGTTGTGGGTGGATGG + Intronic
991035403 5:62123074-62123096 GTGGAGAAGATCAGGATGGAGGG + Intergenic
991487886 5:67156745-67156767 GTGAAGGGGTTGAGGCCGCAGGG + Intronic
991561424 5:67957701-67957723 GACAAGAAGCTGAGGCCGGAGGG + Intergenic
993193926 5:84715871-84715893 ATGAACAAGATGAGGCAGGAAGG - Intergenic
994207894 5:97056434-97056456 GTGAAGAAGATGAAGATGAAGGG - Intergenic
996814642 5:127561440-127561462 ATGAAGAATCTGAGGCTGAAAGG - Intergenic
996975972 5:129435111-129435133 CCCAAGAAGTTGAGGCTGAATGG - Intergenic
998682757 5:144488445-144488467 ATGAAGAAATTGAGGCTTCAAGG - Intergenic
999076881 5:148804791-148804813 GTGAGGAAATTGAGGCTGACAGG - Intergenic
999129065 5:149268619-149268641 GTGAAGCAGTTCAGGTTGGCTGG - Intergenic
999644676 5:153705944-153705966 GTGAAGAGTTTGAGGAAGGACGG + Exonic
999736464 5:154517002-154517024 GTCAGGAAGTTGCGGCAGGAGGG + Intergenic
999780644 5:154847387-154847409 GGGAATAAGGTGAGGCTGGAAGG + Intronic
999948338 5:156621629-156621651 GTGATTAAGTTGAGACTGGAAGG + Intronic
1000143365 5:158428604-158428626 GTGAAGAGGTTGAGGAGGGAGGG - Intergenic
1001242662 5:170081985-170082007 GTGAGGACATTGAGGGTGGAAGG + Intronic
1001295605 5:170496763-170496785 GTGGTGAGGTTGAGGGTGGACGG - Intronic
1001850822 5:174963424-174963446 ATGAAGCAGTTGGGGCTGGTTGG - Intergenic
1001878356 5:175220387-175220409 GTGAAGAAACTGAGGCTGGGTGG - Intergenic
1004116514 6:12773420-12773442 GTGAATCAGGTGAGGCTAGATGG - Intronic
1005822227 6:29607416-29607438 GTGTGGAAGTAGAGGGTGGATGG - Intronic
1006075981 6:31532865-31532887 GAGACGAAGTTGACGCTGCATGG - Exonic
1006482509 6:34308369-34308391 GTGGACAACTTGAGGCTGGGAGG + Intronic
1007122720 6:39396646-39396668 ATGAAGAAATTGAGGCTCAAAGG - Intronic
1007238594 6:40409048-40409070 ATGAAGAAGTGGAGCCTGTAAGG - Intronic
1007986355 6:46211071-46211093 CTGAAGAAGTGGAGCATGGAAGG - Intergenic
1010024788 6:71202508-71202530 GTGAAAAAATTGAGGCTTGGAGG - Intergenic
1010754507 6:79651822-79651844 GTGAAGGAGATGATTCTGGAGGG + Intronic
1012240359 6:96864181-96864203 GTCAGGAAGTTGAGGCTGCAGGG + Intergenic
1012490512 6:99778447-99778469 GAGAATAACTTGAGGCTGGGAGG + Intergenic
1013179755 6:107707997-107708019 GAGAAGGGCTTGAGGCTGGATGG + Exonic
1013974691 6:116063856-116063878 GAGAAGAAACTGAGGCTGAAAGG + Intergenic
1015411013 6:132894097-132894119 GAAAAGAAGTTGAGGATGGGGGG - Intergenic
1015614852 6:135064030-135064052 GTGTTGAAGTTAATGCTGGAGGG - Intronic
1015991241 6:138945620-138945642 CTGAAGAATATGAGGCTGCATGG + Exonic
1016553229 6:145306280-145306302 GTGATGATGTTGAGTCTGGTTGG + Intergenic
1016909109 6:149179395-149179417 GTGGAGAAGGTGAGGCAGGGAGG + Intergenic
1018392073 6:163348213-163348235 GTGAAGGATTTGGGGATGGAGGG + Intergenic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1019034684 6:169044485-169044507 GTGAGGAAACTCAGGCTGGAAGG - Intergenic
1019662431 7:2232447-2232469 GTGGAGAAGTCGGGGCTGCAGGG - Intronic
1019696393 7:2448582-2448604 GGGAAGAAGCTGAGGGTGGGTGG - Intergenic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020792217 7:12641248-12641270 GAGAAGAAGTTGCAGGTGGAGGG - Intronic
1021659587 7:22906918-22906940 TTGCAGAAGTTGGGGTTGGAAGG + Intergenic
1022175755 7:27870301-27870323 GTGAGCAAGTTGGGGCTGGAGGG - Intronic
1023765283 7:43504809-43504831 TTGAAGAAGTTTCTGCTGGATGG - Intronic
1024504086 7:50146675-50146697 GTGAGGCAGATGTGGCTGGAGGG - Intronic
1025610841 7:63074317-63074339 GAGAAAAAGATTAGGCTGGAAGG - Intergenic
1026240169 7:68566979-68567001 GTTAAAAAGTTGAGGGTGGGAGG + Intergenic
1030468822 7:109937823-109937845 GGGTAGAAGTTCAGGCTGGAAGG + Intergenic
1031843499 7:126775870-126775892 GTGCAGCAGATGAAGCTGGAGGG - Intronic
1032483283 7:132263458-132263480 GTAAAGAAGCTGAGGCTCGGAGG - Intronic
1032491933 7:132330249-132330271 GGGAAGAAGGTGAAGCTGGAGGG + Intronic
1033708243 7:143909833-143909855 GAGAAGAAGTTGAAGTTGAAGGG + Intergenic
1033982722 7:147186157-147186179 GTGAAGAAGATGGGAATGGAAGG + Intronic
1034274674 7:149818813-149818835 GATCAGAAGTTGAGGCTGGAAGG - Intergenic
1035287407 7:157815156-157815178 GTGAGGACGGTGAGGCTGAAGGG - Intronic
1036098417 8:5750695-5750717 GGGAAGTAATTGAGGCAGGAGGG + Intergenic
1036209230 8:6828558-6828580 GGGAGGAAGCTGAGGCGGGATGG + Intronic
1036752135 8:11450017-11450039 GTGGAGAATGCGAGGCTGGAAGG - Intronic
1036968715 8:13330070-13330092 CTGAGGAAGTTGAGGTGGGAGGG - Intronic
1037853161 8:22349514-22349536 CTGAAGAAATTGAGTCTTGAAGG + Intronic
1038934461 8:32233189-32233211 GTGAACAGCTTGAGCCTGGAAGG - Intronic
1039080735 8:33731777-33731799 GTGTATATGTTGAGGCTGTAGGG + Intergenic
1039376317 8:37037765-37037787 ATGAAGAAATGGAGGCTGAAAGG + Intergenic
1040770107 8:50963699-50963721 GTCAGGAACTTGAGGCAGGATGG + Intergenic
1040770189 8:50965058-50965080 GTCAGGAACTTGAGGCAGGATGG + Intergenic
1042199601 8:66268729-66268751 GTGAAGATGAGGAGCCTGGAGGG - Intergenic
1043060407 8:75493297-75493319 GGGAAGAAATGGAGGCTGGTTGG + Intronic
1043464065 8:80487318-80487340 GGGAAGGAGTTGATGCAGGACGG + Exonic
1044594426 8:93944021-93944043 GTGAGGAAGTTGATGCCTGAGGG + Intergenic
1044734037 8:95259347-95259369 GTGAGAAAGTGGAGGCAGGAAGG + Intronic
1045783079 8:105890566-105890588 CTCAGGAAGCTGAGGCTGGAGGG + Intergenic
1046583715 8:116124953-116124975 GTGAGGAAGTTGAGTTTGGAAGG - Intergenic
1046733461 8:117750892-117750914 GTGATTAAGTAGAGGCTGGTGGG - Intergenic
1047519052 8:125580392-125580414 GTGAACAAGTTGGGGTGGGAAGG + Intergenic
1048611793 8:136030942-136030964 GTGAAGGGGATGATGCTGGAAGG + Intergenic
1049047051 8:140161021-140161043 ATGAGGAAGTTGAGGCTTGGAGG + Intronic
1049404307 8:142444906-142444928 GTGCAGATGTTGAGGAAGGATGG - Intergenic
1051653314 9:19352542-19352564 ATGAAGAAATTATGGCTGGATGG + Exonic
1052240309 9:26264151-26264173 GGGACCAAGTTGAGGGTGGAGGG + Intergenic
1053146885 9:35718113-35718135 GTAAAGAAGCTGGGGGTGGAGGG - Intronic
1053327644 9:37169953-37169975 CTCAAGAGGCTGAGGCTGGAGGG + Intronic
1054910325 9:70449361-70449383 GGGAGGAAGTTGAGGCTGGCGGG - Intergenic
1056159121 9:83870803-83870825 GTTAAGAAAATGTGGCTGGATGG - Intronic
1056351451 9:85753119-85753141 GTTAAGAAAATGTGGCTGGATGG + Intergenic
1056775272 9:89507772-89507794 GTGTTGATGTTGATGCTGGAGGG + Intergenic
1056959993 9:91114752-91114774 GAGAAGAAAAGGAGGCTGGAGGG - Intergenic
1057220931 9:93257394-93257416 GTAGAGAAGGTGAGGCTGGAGGG - Intronic
1057549841 9:96044326-96044348 GTTAAGAAAGTCAGGCTGGATGG + Intergenic
1058138026 9:101328838-101328860 GTGAAGAACTGAAGGCTGGCTGG + Intergenic
1058365912 9:104208069-104208091 GTGCAGAACTTTAGGCTGGTGGG - Intergenic
1058806893 9:108601544-108601566 GTGAACATTTTCAGGCTGGATGG - Intergenic
1059106481 9:111516061-111516083 GTGAAGCTGTTGAGGATGCAGGG - Intergenic
1059116513 9:111604568-111604590 GGGTAGAAGGAGAGGCTGGAAGG - Intergenic
1059639209 9:116200117-116200139 TTGAGGAAGATGAAGCTGGAGGG - Intronic
1059762415 9:117351041-117351063 GTGTAGACGTTGAGGGTGCAAGG - Intronic
1060205435 9:121680163-121680185 GTGTAGGAGGTGAGGCTGGGAGG + Intronic
1060419928 9:123461125-123461147 ATGAAGAAGGTGAGGAAGGAAGG - Intronic
1061421578 9:130475622-130475644 ATGAAGAAATTGAGGCTGAGCGG - Intronic
1061930277 9:133828822-133828844 GTGTGGAAGGCGAGGCTGGAGGG - Intronic
1062128979 9:134882528-134882550 GTGAAGATGGTGGGCCTGGAGGG + Exonic
1062214934 9:135384092-135384114 GGCAAGGAGCTGAGGCTGGACGG + Intergenic
1062222474 9:135424766-135424788 GTGCTGATGTTGATGCTGGAGGG - Intergenic
1062480314 9:136747998-136748020 CTGCAGAACTGGAGGCTGGAGGG - Intronic
1062480324 9:136748036-136748058 CTGTAGAACTGGAGGCTGGAGGG - Intronic
1062480345 9:136748119-136748141 TTGGAGAACTGGAGGCTGGAGGG - Intronic
1185864627 X:3612542-3612564 TTTAAGAAGGTGAGGCGGGAGGG + Intronic
1186390667 X:9155576-9155598 GTGAAGAAGTAGAGACTGATTGG - Intronic
1186519501 X:10192968-10192990 GGGACGAAGCTGAGGCTGGGAGG + Intronic
1187017860 X:15348362-15348384 GTGAAGAAGAATAGGTTGGAGGG - Intronic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1187415840 X:19092647-19092669 GTGAGGAGGGTGAGGCTGGAGGG - Intronic
1187804218 X:23100570-23100592 GTGAAGAAAATGAGGGTGGTGGG - Intergenic
1187836353 X:23435900-23435922 GTGTTGGAGTTGAGGCTTGATGG + Intergenic
1188368643 X:29341535-29341557 ATGAAAAAGTTGAGTCTGAAGGG + Intronic
1189426831 X:40909411-40909433 GTGGAAAAGTGGGGGCTGGAGGG + Intergenic
1190128385 X:47725124-47725146 GTGAAGGAGAGGAGGGTGGAGGG - Intergenic
1190543497 X:51501407-51501429 GTGAAGAAGGTGGGGCTAGCTGG + Intergenic
1191731757 X:64343807-64343829 GTGAGGAAGCTGAGGCAGAAAGG + Intronic
1192224329 X:69217860-69217882 GTTTGGAAGTAGAGGCTGGATGG + Intergenic
1192327033 X:70141781-70141803 ATAAAGAAATTGAGGCTGGTGGG - Intronic
1193212835 X:78827861-78827883 GTGAAGAAACTGAGGCTCAATGG - Intergenic
1193300259 X:79881060-79881082 GTGAAGAAACTGAGGGTGGATGG + Intergenic
1193484727 X:82072541-82072563 GTGAAGCATTGGAGGGTGGAGGG - Intergenic
1194605524 X:95974181-95974203 TTGGAGAAGTTAAGGCTGCAAGG - Intergenic
1195731289 X:107970394-107970416 GAGAAGAAGTTGTGACTAGATGG - Intergenic
1197700823 X:129598213-129598235 GTGGAGAGGTGGGGGCTGGAGGG - Intergenic
1198215954 X:134554976-134554998 ATAAAGAAGGTGTGGCTGGAGGG - Intergenic
1199520457 X:148729421-148729443 GCAAAGGAGATGAGGCTGGATGG + Intronic
1200144693 X:153920612-153920634 GTGGAGAAGGTGGGCCTGGAGGG - Exonic
1200799327 Y:7371504-7371526 TTTAAGAAGCTGAGGCAGGAGGG - Intergenic