ID: 1181028013

View in Genome Browser
Species Human (GRCh38)
Location 22:20136814-20136836
Sequence GTGCACACACACAAATATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 712
Summary {0: 1, 1: 0, 2: 5, 3: 104, 4: 602}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181028013_1181028014 2 Left 1181028013 22:20136814-20136836 CCTGTATATTTGTGTGTGTGCAC 0: 1
1: 0
2: 5
3: 104
4: 602
Right 1181028014 22:20136839-20136861 ATACCCATGCACATGTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181028013 Original CRISPR GTGCACACACACAAATATAC AGG (reversed) Intronic
900563679 1:3321503-3321525 GCACCCCCACACAAATATACAGG - Intronic
900581312 1:3411176-3411198 GTGCGTACACACAAATACACAGG - Intronic
900788068 1:4662037-4662059 ACACACACACACAAATATAAAGG - Intronic
901326871 1:8371895-8371917 GTGCACACATGCACATACACAGG - Intronic
901662231 1:10805767-10805789 GTGGACACACACATTCATACGGG - Intergenic
902147857 1:14418852-14418874 TTGCACACACACAAGTGTACTGG - Intergenic
902773333 1:18659023-18659045 ATGCACACACATATACATACAGG - Intronic
902787694 1:18743761-18743783 CTGCACATACACAAATATAGAGG + Intronic
903599331 1:24523555-24523577 GTATACACACACATATATAAAGG + Intronic
904453806 1:30634549-30634571 ATGCACACACACACACATAGAGG - Intergenic
905088645 1:35408240-35408262 GTACACACCCAGATATATACTGG + Intronic
905155458 1:35975596-35975618 GTGCACACATACATATGTATTGG + Intronic
905346912 1:37317619-37317641 TGGCACACACACAAATAAACAGG + Intergenic
905495482 1:38381994-38382016 TTACACACACACAAAAAAACTGG + Intergenic
906043033 1:42804251-42804273 ACACACACACAGAAATATACAGG + Intergenic
909135065 1:71787729-71787751 TTGTACACACACAAATCTGCAGG - Intronic
909362505 1:74779877-74779899 GTCCACACACAGATCTATACAGG - Intergenic
909576056 1:77177658-77177680 GCACACACACAGAAATATAGAGG - Intronic
910015304 1:82516698-82516720 ACACACACACACATATATACAGG + Intergenic
910054716 1:83019421-83019443 ATATACACACACACATATACAGG + Intergenic
910276319 1:85452980-85453002 ATACACACACACACATACACAGG - Intronic
910353460 1:86327168-86327190 ATAAACACACACAAATACACTGG + Intergenic
910574980 1:88751305-88751327 GTGTAGACACACATACATACAGG + Intronic
911285543 1:95987739-95987761 GTCCAAACACAGAAATATATTGG + Intergenic
911413316 1:97538813-97538835 AGACACACACACAAATATTCTGG - Intronic
911946541 1:104116313-104116335 ATGCACATAAACATATATACTGG - Intergenic
911965446 1:104363089-104363111 CTGCACACACACACAAAAACGGG + Intergenic
912392075 1:109310169-109310191 GTACACACACATATATATAAAGG + Exonic
912614744 1:111086538-111086560 ATACACACACACACATATATGGG + Intergenic
915049186 1:153049635-153049657 ATGCACACACTCACATGTACTGG - Intergenic
915207390 1:154280267-154280289 ATGCACACACACAACTGTGCTGG + Intergenic
915555875 1:156660387-156660409 GTACACACACACACACACACAGG - Intergenic
915810136 1:158900355-158900377 ACACACACACACAAATATAGAGG + Intergenic
916622367 1:166513416-166513438 GCACACACACACACACATACAGG + Intergenic
916886522 1:169073690-169073712 ATGCACACACACAAGCACACAGG + Intergenic
917517675 1:175721733-175721755 GTTCACACACTCAAATCAACTGG + Intronic
918056372 1:181025236-181025258 CCGAAAACACACAAATATACTGG - Intergenic
918307777 1:183262950-183262972 TGGCACAAAAACAAATATACTGG + Intronic
918452297 1:184671258-184671280 GTGCACACACACACACACACAGG - Intergenic
918454771 1:184697989-184698011 GCGCACACACACAAACAGAGAGG + Intronic
918691253 1:187482589-187482611 ATGCACACACACATGCATACTGG + Intergenic
918764799 1:188466604-188466626 GTGCACACATACATATATCCTGG + Intergenic
919399352 1:197091227-197091249 GTGCACACACACACACACACAGG - Intronic
919693376 1:200547461-200547483 GTACACACACACACACAAACAGG + Intergenic
920212239 1:204336586-204336608 GTGCACGCACATACATACACTGG + Intronic
920284096 1:204867313-204867335 GTGCCCACAAACACACATACAGG + Intronic
921231245 1:213073983-213074005 GTACACACTCAGAAATATATCGG + Intronic
921233237 1:213095607-213095629 ATACACACACAGAAATATATAGG + Intronic
921258242 1:213361934-213361956 GTGCACACAGACAACTGTAGAGG - Intergenic
922588443 1:226753634-226753656 ACGCACACACACACATATACAGG - Intergenic
922925761 1:229345538-229345560 ACACACACACACAAATATAAGGG + Intergenic
923416095 1:233762077-233762099 ATACACACACATACATATACAGG - Intergenic
923861056 1:237892484-237892506 ACACACACACACAAATATAGAGG + Intergenic
924316792 1:242806216-242806238 CTACACACACACAAAGAAACTGG - Intergenic
924417100 1:243867819-243867841 GTGTGCACACACAAACACACAGG - Intergenic
924507915 1:244703515-244703537 TTACACACACACAAATTTGCTGG - Intronic
924765679 1:247030095-247030117 ACACACACACACAAATATAGAGG - Intergenic
1062999668 10:1904082-1904104 GTGCATACACACACACACACAGG + Intergenic
1063121943 10:3111201-3111223 GCACACACACACAAACATGCAGG - Intronic
1063308059 10:4924777-4924799 GTGCACACACATACACACACAGG + Intronic
1063308576 10:4931255-4931277 GGGCACACACACATACACACAGG + Intronic
1063729106 10:8675918-8675940 GTGAAAACAGACTAATATACTGG - Intergenic
1063855756 10:10251701-10251723 ACACACACACACAAATATAAAGG + Intergenic
1063887062 10:10590159-10590181 ATGCACACACACACACACACAGG + Intergenic
1064155506 10:12900248-12900270 ATGCTCACACACACATATAAAGG - Intronic
1064266647 10:13830746-13830768 GTGCACACATACACACACACAGG - Intronic
1064711971 10:18137535-18137557 TTTCACACACACATACATACAGG + Intergenic
1064870678 10:19933682-19933704 GTGCACACACACACACACAAAGG + Intronic
1065883911 10:30059933-30059955 GCGCACACAAACACATATACAGG + Intronic
1066392488 10:34989116-34989138 ATACACACACACACATATGCAGG - Intergenic
1066530305 10:36330747-36330769 ACACACACACACAAATACACAGG + Intergenic
1067164996 10:43858578-43858600 ATACACACACACACATATACAGG - Intergenic
1067472507 10:46547208-46547230 GTGCACACACACGCATACACAGG - Intergenic
1067775516 10:49162322-49162344 ATGCACACACACATATAGACAGG + Intronic
1068075415 10:52247847-52247869 ACGCACACACAGAAATATAGAGG + Intronic
1068391232 10:56399483-56399505 GTGCACATACACACATTCACTGG - Intergenic
1069787725 10:70999621-70999643 GTGCACACACACAGAGACATAGG - Intergenic
1069787727 10:70999660-70999682 GTGCACACACACAGAGACAGAGG - Intergenic
1070894831 10:79974838-79974860 ATACACACACAGAAATATAGAGG + Intronic
1072186872 10:93048108-93048130 ATGCACACACAGAAACACACAGG - Intronic
1072526892 10:96279868-96279890 ATTCACACACACACATACACAGG + Intergenic
1073024017 10:100472629-100472651 ATACACACACACACGTATACTGG + Intronic
1073988224 10:109233632-109233654 GAACACACACACAAGTATATAGG - Intergenic
1074010884 10:109478280-109478302 TTGCAAACACAAAATTATACAGG - Intergenic
1074098671 10:110335828-110335850 GTGCACACACACAAACGTTGAGG - Intergenic
1075179343 10:120196105-120196127 GTGCACACACACACATTATCAGG - Intergenic
1076245467 10:128944454-128944476 GTACACACACACATGCATACAGG + Intergenic
1076534504 10:131168178-131168200 ATGCACACACACACATAGAAAGG + Intronic
1077425060 11:2471603-2471625 GTGCACACACCCATATACACAGG - Intronic
1077438198 11:2555009-2555031 GTGCACACACACACGTCCACAGG + Intronic
1077502390 11:2915278-2915300 GCGCACACACACACACACACGGG - Intronic
1077548810 11:3190181-3190203 GTGCAAAGACACAAATAAATAGG + Intergenic
1077586463 11:3457625-3457647 GCGCACACACACAAAAACAAAGG - Intergenic
1077741676 11:4853229-4853251 ATGCACACACACACATACAAGGG + Intronic
1078069262 11:8097580-8097602 GTGCACACACACAAATGCACTGG - Intronic
1079700005 11:23534203-23534225 GAGCACACAGACAACTCTACGGG - Intergenic
1080165290 11:29228343-29228365 TTATACACACACAAATACACAGG - Intergenic
1081540030 11:44027771-44027793 ATGCATACACACAAACATGCAGG - Intergenic
1082251136 11:49981728-49981750 GCGCAGATACACAAATATACAGG + Exonic
1082558576 11:54592231-54592253 GCACAGATACACAAATATACAGG - Intergenic
1083820635 11:65169509-65169531 GTGCACACACACAAACAGGATGG + Intergenic
1084506002 11:69568496-69568518 GTGCACACACACACAAACACAGG - Intergenic
1084506010 11:69568620-69568642 GTGCACACACACACAAACACAGG - Intergenic
1084506013 11:69568655-69568677 GTGCACACACACACAAACACAGG - Intergenic
1084506016 11:69568690-69568712 GTGCACACACACACAAACACAGG - Intergenic
1084506018 11:69568725-69568747 GTGCACACACACACAAACACAGG - Intergenic
1084895840 11:72267425-72267447 CTGCACAAACACATAGATACAGG - Intergenic
1085188216 11:74594301-74594323 GTGCAAAGATACAGATATACAGG - Intronic
1085237160 11:75023954-75023976 GTGCACACACACACAAAGAGAGG - Intergenic
1085452206 11:76641214-76641236 GGGCACACAGACATATATACAGG + Intergenic
1085690165 11:78657940-78657962 GTGCAGAAACAAAAAGATACTGG - Exonic
1086747645 11:90450178-90450200 GGTCACACACACAAACACACTGG - Intergenic
1087900902 11:103639381-103639403 GTGCACAGACATAAAAATTCAGG + Intergenic
1087935847 11:104034210-104034232 ATGCACACACACAAATTGAAGGG - Intronic
1088181028 11:107111144-107111166 ATACACACACACAAACACACAGG + Intergenic
1088216740 11:107518867-107518889 AGACACACACACAAATATAGAGG - Intronic
1088440257 11:109862635-109862657 ATACACACACACATATATATAGG - Intergenic
1088836086 11:113578848-113578870 ACACACACACACATATATACAGG + Intergenic
1089199580 11:116715704-116715726 GTCCACACACACACACACACCGG + Intergenic
1089598751 11:119599900-119599922 ATGCACACACATTAATACACAGG - Intergenic
1089758753 11:120707420-120707442 GTGTAGACACACAAATGTGCAGG - Intronic
1089797307 11:120991862-120991884 GTGCACGCACACACACACACTGG - Intergenic
1090367246 11:126217001-126217023 ATGCACACACACACAAACACAGG + Intronic
1090996141 11:131867573-131867595 GTGTACACACACATACACACAGG - Intronic
1091224194 11:133947670-133947692 GTGCACGCACACACACATGCTGG + Intronic
1091318161 11:134630684-134630706 GTGTATACACACACATACACAGG - Intergenic
1091529412 12:1339926-1339948 GTGCACACACACATGCACACTGG + Intronic
1091664662 12:2410628-2410650 ATGCACACACACACACACACAGG - Intronic
1091675983 12:2490006-2490028 GTGAACACACACAAATCAGCAGG - Intronic
1092513522 12:9184128-9184150 GTGCACACACACACATGTGTTGG - Intronic
1092902278 12:13071156-13071178 ATGCACACACAAAAATGCACAGG - Intronic
1093078342 12:14780554-14780576 GAGGACACAGACAAAAATACAGG - Intergenic
1093080831 12:14808776-14808798 GCACACATACACATATATACAGG + Intronic
1093254971 12:16855747-16855769 GTGAACACACACATACACACAGG - Intergenic
1094015824 12:25862950-25862972 ATACACACACACACATATAATGG - Intergenic
1095343026 12:41114706-41114728 GAGCACACACACAAATAATCAGG + Intergenic
1096579174 12:52573455-52573477 GGGCACACAGACAAACATGCAGG + Exonic
1096736587 12:53660297-53660319 GTGCACACACACACACATACAGG + Intronic
1098391650 12:69975961-69975983 GTGCAAACACACACACATATTGG + Intergenic
1098621816 12:72610590-72610612 GTGCACACACACACACACGCAGG - Intronic
1099698259 12:86049303-86049325 GTACACACACACACACACACAGG - Intronic
1099827489 12:87796263-87796285 ATACACACACACACATACACCGG + Intergenic
1099854523 12:88146582-88146604 ACACACACACACAAATATATAGG - Intronic
1100137324 12:91569541-91569563 ATACACACACACACATATAAAGG - Intergenic
1100218960 12:92483109-92483131 TTGAACACAGACACATATACAGG + Intergenic
1100692130 12:97049214-97049236 TTACTCACACACAAATATAAAGG - Intergenic
1100711152 12:97258292-97258314 TTGCACACACACAAGTACATTGG + Intergenic
1102017670 12:109658446-109658468 GTGCACACACACACATACGTCGG + Intergenic
1102449866 12:113033382-113033404 GTGAAAACAGACAAATACACTGG + Intergenic
1102816434 12:115869906-115869928 GAGCACACAGACAAGTAGACAGG + Intergenic
1102832601 12:116018941-116018963 GTGAACACATACACACATACAGG + Intronic
1103696212 12:122817793-122817815 ATGCACACACACACATGTGCAGG - Intronic
1104119257 12:125783345-125783367 GTGCACACACACATGTACAAGGG + Intergenic
1104194372 12:126518819-126518841 GTGCACACAAACACATACATAGG - Intergenic
1104424619 12:128665373-128665395 GTGCACACACACACAGACACAGG + Intronic
1104483759 12:129131199-129131221 ATGCACACACACACAGAAACAGG + Intronic
1105035334 12:132916003-132916025 GTGCACACACACACAACTACAGG - Intronic
1105920280 13:24956866-24956888 GTGCACATACACAAACATCTTGG + Intergenic
1105982353 13:25531116-25531138 ACACACACACACAAATATATAGG - Intronic
1106610191 13:31271540-31271562 CACCACACACACAAATATACTGG - Intronic
1106889647 13:34231007-34231029 ATGCACACACATATATACACTGG - Intergenic
1107291205 13:38855984-38856006 ACACACACACCCAAATATACTGG + Intronic
1107416285 13:40203872-40203894 GGTCACACACACAAACATATGGG + Intergenic
1107801614 13:44113503-44113525 GGGGACACACACAAAAAAACAGG + Intergenic
1108290683 13:48957452-48957474 GTGCATACAAACAAACATTCAGG + Intergenic
1108328156 13:49355781-49355803 ATACACACACACATATATAAAGG + Intronic
1108800216 13:54085913-54085935 ATACACACACACACATATATAGG + Intergenic
1108958782 13:56195254-56195276 ATACACACACACATATTTACAGG - Intergenic
1110393609 13:75004311-75004333 GTACACACAGACAAAAATATGGG - Intergenic
1110550042 13:76801787-76801809 GTGTATACACACAAATGTATTGG + Intergenic
1110973806 13:81804104-81804126 GAAAACACACACAAATATACAGG - Intergenic
1112640737 13:101272159-101272181 GTACACACACACACTCATACAGG - Intronic
1114649314 14:24273707-24273729 GTGCACACACACAGAATTACAGG + Intergenic
1115116162 14:29882856-29882878 GTGCACACACACACACACAGTGG - Intronic
1115128386 14:30023749-30023771 ACGCACACACAGAAATATAGAGG - Intronic
1115478970 14:33843238-33843260 GTGCGCACACACACCCATACAGG - Intergenic
1115862670 14:37706104-37706126 GTGCCCTCACACATACATACGGG - Intronic
1115888201 14:37997538-37997560 ATGCACACATACATATACACAGG + Intronic
1116779745 14:49223958-49223980 TTACACACACACATATATAAAGG + Intergenic
1116833349 14:49744283-49744305 ACACACACACACATATATACAGG - Intronic
1117449272 14:55835211-55835233 ACACACACACACATATATACTGG - Intergenic
1117757881 14:58995313-58995335 TTGCTCACACACAAATTTATCGG - Intergenic
1118230739 14:63946436-63946458 ATACACATACACATATATACTGG + Intronic
1118255651 14:64203031-64203053 GTGAAAACACATAGATATACGGG - Intronic
1118587590 14:67369898-67369920 ACACACACACACAAATATAGGGG + Intronic
1119035590 14:71228004-71228026 GTGCGCACACACACATGCACAGG + Intergenic
1119510324 14:75206364-75206386 GTACACACTTACAAACATACAGG + Intergenic
1120359681 14:83482683-83482705 GCACACACACACAAAAATCCTGG + Intergenic
1120401612 14:84039656-84039678 ATGCATACACACAAATTTCCAGG + Intergenic
1120450994 14:84666537-84666559 GTCCACATACACAAATACACAGG + Intergenic
1120600641 14:86501982-86502004 GTGCATACACACAAATGATCAGG + Intergenic
1122565398 14:102651171-102651193 ACACACACACACAAATATAGAGG + Intronic
1122632491 14:103113414-103113436 GTGCACACACACACACCTGCTGG + Intergenic
1122957473 14:105077502-105077524 GTGCACACACACACACACACAGG + Intergenic
1122957475 14:105077550-105077572 GTGCACACACACTCAGACACAGG + Intergenic
1123543346 15:21317473-21317495 GTGCACACACACACACCTCCAGG + Intergenic
1123786292 15:23678031-23678053 GACCACACACACAAGCATACGGG - Intergenic
1124133007 15:27006693-27006715 GTACACACAGACAAATAGAAAGG - Intronic
1124291891 15:28459410-28459432 GTACACACAGACACATATCCAGG + Intergenic
1127816144 15:62610840-62610862 GTGCACATACAGAGATACACAGG - Intronic
1129056677 15:72825204-72825226 ATGCACACACACAGAGACACAGG - Intergenic
1129243545 15:74266331-74266353 GTGCACACACTGAGATACACAGG - Intronic
1129930492 15:79406526-79406548 GTGCACACATACAATTATTCTGG + Intronic
1130080149 15:80725920-80725942 ATACACACACAGAAATATAGAGG + Intronic
1130136469 15:81185687-81185709 CTGTACACACATAAATATAACGG + Intronic
1130789663 15:87140157-87140179 ACACACACACACACATATACTGG + Intergenic
1131084309 15:89563251-89563273 ATACACACACACACATATAAAGG - Intergenic
1131318222 15:91360527-91360549 GTGCATAAACACAAATACAAAGG - Intergenic
1132130606 15:99275135-99275157 ACGCACACACACAAGTATATAGG - Intronic
1132726300 16:1339803-1339825 GTGCACACAGACACACACACAGG + Intronic
1132726328 16:1340210-1340232 GTGCACACAGACACACACACAGG + Intronic
1132726332 16:1340272-1340294 GTGCACACAGACACACACACAGG + Intronic
1133684913 16:8157274-8157296 ATATACACACACATATATACAGG - Intergenic
1134379827 16:13713510-13713532 ATGCACACACACACACATGCAGG + Intergenic
1134871982 16:17660337-17660359 GTGCACACACACACATACAGAGG + Intergenic
1135428737 16:22363651-22363673 GTGCACAGACACAAAAGTCCTGG + Intronic
1135728964 16:24878527-24878549 GTGCACAGACACAAACACACTGG + Intronic
1135838647 16:25852867-25852889 TTGCACACACAAAATTAAACTGG - Intronic
1135840041 16:25867880-25867902 ATACACACACACAGATACACAGG + Intronic
1136268762 16:29136152-29136174 GAGCACACACAGACAAATACAGG - Intergenic
1136471147 16:30481183-30481205 CCACACACACACAAATATTCGGG + Intronic
1137502203 16:49020052-49020074 GTGCACACACTTATATACACAGG + Intergenic
1138033833 16:53582337-53582359 ATGCACACACACAAGTTTTCTGG + Intergenic
1138371265 16:56528609-56528631 GTGCACACTCACCAAGATCCTGG + Intergenic
1138496968 16:57414844-57414866 ATGCACACCCACAAACACACGGG + Intronic
1139010652 16:62628965-62628987 TGGCACACACACAAAAATCCTGG - Intergenic
1139111089 16:63891700-63891722 ATGCACACATAGAAATATATTGG + Intergenic
1140009395 16:71115611-71115633 GTGCACACACACACACACTCAGG + Intronic
1140320062 16:73941750-73941772 GTGTACACACATAAATAAAATGG + Intergenic
1140494949 16:75377375-75377397 GTGGACTCACACCAATATAGTGG - Intronic
1141216453 16:82029565-82029587 GTGCACAAGCACACACATACAGG + Intergenic
1141545505 16:84765252-84765274 GTGCACACACACACACACAAGGG - Intronic
1142072067 16:88096518-88096540 GAGCACACACAGACAAATACAGG - Intronic
1143300786 17:5909383-5909405 ATGCACACACAGAAAAACACAGG + Intronic
1143579252 17:7815730-7815752 GGGATCACACACACATATACAGG + Intronic
1146138245 17:30341996-30342018 ATGCATACACATAAATATGCAGG - Intergenic
1146425496 17:32733582-32733604 GTGCACACACACACACACAATGG - Intronic
1146583155 17:34057983-34058005 GTGCACGCACACAAGTACATGGG - Intronic
1146938948 17:36830383-36830405 GTGCACAAAGAGAAATATACAGG + Intergenic
1147468330 17:40631039-40631061 GCACACACACACACACATACAGG - Intronic
1148843412 17:50513930-50513952 GTGCACACAAACACACATGCAGG - Intronic
1149109893 17:53015996-53016018 ATGCACACACACATATACATAGG - Intergenic
1149200496 17:54180567-54180589 GTGCACACACACATCCACACAGG + Intergenic
1149225713 17:54467800-54467822 GTGCACACACACACACACAAAGG - Intergenic
1149817489 17:59740133-59740155 TTGAACATTCACAAATATACTGG + Intronic
1150410298 17:64936258-64936280 GTGCACACACACACACACACGGG - Intergenic
1151497144 17:74465185-74465207 ATACACACACACAAACACACAGG - Intergenic
1152160823 17:78667506-78667528 CTACACACACACAAAAAAACGGG - Intergenic
1152791287 17:82281511-82281533 ATGAACACACACACATACACGGG - Intergenic
1152847059 17:82607518-82607540 ATACACACACACACATATATAGG - Intronic
1152855062 17:82660686-82660708 GTACACACACACACACACACAGG + Intronic
1152858714 17:82682119-82682141 ATGCACACACACACACACACAGG + Intronic
1152999367 18:439989-440011 ATGCACACACACACACACACTGG + Intronic
1153369331 18:4296326-4296348 ATACACACACACAAATAAAGAGG + Intronic
1153596349 18:6729336-6729358 GCGCACACACACAGACACACAGG + Intergenic
1153718457 18:7875744-7875766 ATACACACATACAAATATACAGG - Intronic
1154286811 18:13065635-13065657 AAGCACACACACATACATACTGG + Intronic
1155128206 18:22901715-22901737 GTGGACACACACACATACAGGGG + Intronic
1155415881 18:25599138-25599160 GTACACACACATATATATCCTGG + Intergenic
1155721864 18:29024308-29024330 ATGCACACACACACGTATGCTGG + Intergenic
1156577941 18:38340458-38340480 GCACACACACACACATATATAGG + Intergenic
1156588421 18:38458945-38458967 GGACACACACACACATATAGGGG + Intergenic
1156657015 18:39300407-39300429 GTGCACACACAAACATACATGGG - Intergenic
1156750050 18:40441325-40441347 GTGCACCCAGACAAAGATGCAGG - Intergenic
1156982287 18:43304904-43304926 ATACACATACACATATATACAGG - Intergenic
1157431265 18:47628829-47628851 CTGTACACACACCAAAATACTGG + Intergenic
1157440126 18:47704633-47704655 GTGCACACACACACACACAGTGG - Intergenic
1157995167 18:52546152-52546174 GTGCACACACACACACACAGAGG + Intronic
1158464017 18:57673595-57673617 ATGTACACACACATACATACAGG - Intronic
1158787230 18:60729440-60729462 ATGCACACACACAAAGATGCAGG - Intergenic
1159156999 18:64597010-64597032 GTGCACACAGACATAAAGACAGG - Intergenic
1159694839 18:71543118-71543140 ACACACACACACAACTATACAGG - Intergenic
1159727770 18:71983823-71983845 GTGTATACACACAAACACACAGG - Intergenic
1159957983 18:74533301-74533323 CTGGACACACACACATACACAGG + Intergenic
1159989609 18:74888917-74888939 GTTCACACACACACATAGGCAGG + Intronic
1160291414 18:77598055-77598077 GAGCACACACAGAAATGGACAGG + Intergenic
1160395656 18:78570459-78570481 GTGCACACACACACAGGCACAGG + Intergenic
1160430651 18:78810242-78810264 GTGCACATTCACACATACACAGG + Intergenic
1160621906 18:80177360-80177382 GTACACACACACACACACACAGG + Intronic
1161353800 19:3808194-3808216 GGGCACACACGCACATACACAGG - Intronic
1161447303 19:4325647-4325669 GGGCACACACACAGACACACAGG - Intronic
1161482363 19:4517435-4517457 GAGCACACAGACAAATATGGAGG + Intronic
1161972610 19:7590954-7590976 GTGCTCACACACACAGACACTGG + Intergenic
1162258280 19:9510947-9510969 GCACACACACAGAAATATAGAGG + Intergenic
1162385928 19:10360674-10360696 ATGCACACACACACACACACAGG + Intronic
1163634104 19:18430509-18430531 AAACATACACACAAATATACCGG - Intronic
1163740374 19:19008127-19008149 GTGAACACACTCAAATCTAAAGG + Intronic
1164235663 19:23331095-23331117 GTGCAAATACACAAATATTTAGG - Intronic
1164578577 19:29420271-29420293 GTGCACACACATACACATAACGG + Intergenic
1164709354 19:30344285-30344307 ACACACACACACAAATATATTGG + Intronic
1164811527 19:31160642-31160664 GCACACACACACAAACACACAGG + Intergenic
1166972292 19:46577293-46577315 GTGAAAACAGACAAATACACTGG + Intronic
1167120985 19:47516357-47516379 GTGCTCACACACAAAATTAGGGG + Intergenic
1167150035 19:47702971-47702993 GTGCACACACACACACACACAGG - Exonic
1167831527 19:52026834-52026856 GTGCACGCACACAAACATTTCGG - Intronic
1168145408 19:54417354-54417376 ATGCACACACACATATGCACAGG + Intronic
925225490 2:2180651-2180673 GTGCACACACAGGCATACACAGG - Intronic
925225507 2:2180847-2180869 GTGCACACACAGGCATACACAGG - Intronic
925225539 2:2181231-2181253 GTGCACACACAGATATACACAGG - Intronic
925725992 2:6871693-6871715 GCACACACACAAAAAAATACAGG - Intronic
926594176 2:14772082-14772104 GTACACACACACATCGATACAGG + Intergenic
926724352 2:15985903-15985925 ATGCACACACACAAACACACAGG - Intergenic
927002284 2:18810706-18810728 GTTCATACACCCAAATATTCAGG + Intergenic
928863850 2:35894815-35894837 TTGCAGACTCACAGATATACTGG + Intergenic
929730829 2:44490012-44490034 ACACACACACACAAATATATGGG + Intronic
930967594 2:57350030-57350052 GTATACACACACATATATAAAGG - Intergenic
931262236 2:60630478-60630500 GTGCACATGCACACATACACAGG + Intergenic
932059836 2:68484963-68484985 GCGCACACACACACACACACAGG - Intronic
933230632 2:79803285-79803307 ATACACACACAGAAATATAGAGG + Intronic
933231659 2:79814590-79814612 GTGTATACACACATATATAATGG - Intronic
935138961 2:100334072-100334094 ACGCACACACAGAAATATAGAGG - Intergenic
935550893 2:104452740-104452762 GTGCACACACCCATACACACGGG - Intergenic
935662564 2:105480286-105480308 TAGCACACACACAAAAAAACAGG + Intergenic
935745446 2:106186504-106186526 ATACACACACACACATATATAGG + Intronic
936065453 2:109328746-109328768 GTTCACACACACAAATGTGGGGG - Intronic
937126471 2:119477933-119477955 GTGCACACACACACATATTTGGG - Intronic
938153998 2:128912802-128912824 GTACAAACACGCAAATATAAGGG + Intergenic
938718159 2:134039829-134039851 GTGGAAACACCCAAATATCCAGG - Intergenic
938823519 2:134982057-134982079 GTACACACACACAATTAGCCAGG - Intronic
939274346 2:139981055-139981077 ATGCATACACACACATATAATGG - Intergenic
939298554 2:140303057-140303079 ATACACACACACATATATATCGG + Intronic
939664951 2:144940260-144940282 GTTCACAAGCACAAATATGCAGG - Intergenic
939986626 2:148835160-148835182 GTGTACACAGACAGATACACAGG - Intergenic
940305684 2:152223590-152223612 GCGCGCACACACACATACACAGG + Intergenic
940310468 2:152273685-152273707 ACACACACACACAAATATAGAGG + Intergenic
941270822 2:163426174-163426196 GTCCACACAATCAAATATGCTGG + Intergenic
941354196 2:164468549-164468571 CTGCACACACAGACATACACAGG + Intergenic
941758071 2:169209922-169209944 AGGCATACACAGAAATATACAGG + Intronic
942004237 2:171681549-171681571 GCACACACACACACATATTCAGG + Intergenic
942825742 2:180173300-180173322 GTGCACACAAAGAAATCTATAGG + Intergenic
942969145 2:181936189-181936211 GTACACAGACTCAAACATACAGG - Intergenic
943091977 2:183386300-183386322 ATGCACACACAAATATATACAGG - Intergenic
943466091 2:188230888-188230910 ATACACACACAGAAATATAGAGG + Intergenic
943598537 2:189886896-189886918 GAGCACACACACAAAAATGCAGG + Intronic
943923650 2:193742648-193742670 TCACACACACACAAAAATACAGG + Intergenic
944480450 2:200152439-200152461 ACACACACACACAAATATAGAGG - Intergenic
944937752 2:204587095-204587117 ATGCATACACACAATTTTACAGG - Intronic
945249454 2:207751872-207751894 GTACACACACACAAAAATACAGG + Intronic
945585010 2:211650460-211650482 GTGTGCACATATAAATATACAGG + Intronic
945977497 2:216282266-216282288 TTGCACACACACAAGTGTGCTGG - Intronic
946646333 2:221839073-221839095 ACACACACACACACATATACAGG + Intergenic
947377136 2:229508029-229508051 GTGCACACACACACAGATAATGG + Intronic
947968766 2:234304128-234304150 ATACACACACACACACATACAGG - Intergenic
947978021 2:234384557-234384579 GCACACACACAGAAATATAGAGG - Intergenic
1169251608 20:4065153-4065175 GTACACACACAAAAAAATAGAGG - Intergenic
1169790744 20:9407808-9407830 TTGCACACACACAAATTGAAAGG - Intronic
1170419862 20:16182016-16182038 GTGCTCACACACACACATAGAGG + Intergenic
1170444373 20:16410369-16410391 ATACATACACACACATATACAGG + Intronic
1170538991 20:17369396-17369418 ATGCACACACACACACACACAGG + Intronic
1171091476 20:22289575-22289597 GTACACATGCACACATATACGGG - Intergenic
1172543653 20:35742259-35742281 ATACACACACACAAACACACGGG + Intronic
1172715818 20:36962730-36962752 ACGCACACACAGAAATATAGAGG - Intergenic
1172925697 20:38532546-38532568 TTTTACACACACAAATCTACTGG - Intronic
1173882886 20:46431568-46431590 ATGCACACACACACATGTTCTGG + Intronic
1174305889 20:49614076-49614098 CTGCGCTCACACAAACATACAGG - Intergenic
1174545811 20:51324362-51324384 GTGCACACACAGAAAAACAATGG + Intergenic
1174726906 20:52872108-52872130 GTGCGCACACACATATATATAGG - Intergenic
1174924234 20:54739914-54739936 GTCCACACAGACAGATGTACTGG - Intergenic
1175716254 20:61255783-61255805 ATGCACACACACACATACACAGG - Intronic
1176053364 20:63132363-63132385 GTGCACACACGCAAACAGCCGGG + Intergenic
1177465579 21:21474770-21474792 GTGTATACACACACATATATGGG - Intronic
1177507806 21:22040611-22040633 GTGCACTTACACATATATGCTGG + Intergenic
1177526714 21:22302235-22302257 GTGCACACACATATGTATACAGG + Intergenic
1177624411 21:23641627-23641649 ATACGCACACACAAATTTACAGG + Intergenic
1177683804 21:24410631-24410653 ACACACACACACAAATATAGAGG + Intergenic
1178159665 21:29897083-29897105 GTGCACACACACATGCACACAGG - Intronic
1178536689 21:33415823-33415845 GTGCACACACACACACACATTGG - Intronic
1179516195 21:41908826-41908848 GTGTACACACACACACATACAGG + Intronic
1179779869 21:43692703-43692725 ACGCACACACACATATATACTGG - Intronic
1179918350 21:44492948-44492970 GAGCACACACAAAAAAAGACAGG - Intergenic
1180019099 21:45109128-45109150 GCGCACACACACACGCATACAGG - Intronic
1180033613 21:45229859-45229881 ACACACACACACAAAAATACTGG + Intergenic
1180101911 21:45591437-45591459 AGGCACACACACACATACACAGG + Intergenic
1180133645 21:45845466-45845488 GCTCACACACACACATACACAGG - Intronic
1180220172 21:46353585-46353607 ATGCACACACACACACATGCTGG - Intronic
1181028013 22:20136814-20136836 GTGCACACACACAAATATACAGG - Intronic
1181405580 22:22682222-22682244 GTGCACACACACAAGCACACAGG - Intergenic
1181432677 22:22892744-22892766 GTGCACACTCACAACTGTCCAGG - Intronic
1181815457 22:25433451-25433473 TTGCACAAACAAAAATAAACAGG + Intergenic
1182003633 22:26941208-26941230 GGCCACACACACAAAAAAACAGG + Intergenic
1183181131 22:36260459-36260481 GTGCACACACAAATACATACTGG + Intronic
1184914174 22:47557207-47557229 ATACACACACATACATATACAGG - Intergenic
1184914178 22:47557459-47557481 ATACACACACAAACATATACAGG - Intergenic
949159599 3:864586-864608 ACACACACACACAAATATATTGG - Intergenic
949459290 3:4273201-4273223 GTCCACACAAACACATACACAGG + Intronic
949678221 3:6482457-6482479 ACACACACACACAAATATAAAGG + Intergenic
950498711 3:13350251-13350273 GCACACACACACAAACACACAGG - Intronic
950563183 3:13747790-13747812 ATGCACACACACACACACACAGG + Intergenic
951227949 3:20142884-20142906 GTACACACACACACACACACAGG - Intronic
952015091 3:28946930-28946952 TTCCACTCACACTAATATACAGG - Intergenic
952228542 3:31404547-31404569 ACACACACACACAAAAATACTGG + Intergenic
953040682 3:39252690-39252712 GTGCGCACACACAGACCTACGGG + Intergenic
953215543 3:40914571-40914593 GTGCACACACACATATGTCAGGG + Intergenic
953290704 3:41658747-41658769 ACACACACACACATATATACTGG + Intronic
953636098 3:44666385-44666407 GTGCACACGCACACGTATATGGG - Intergenic
953723398 3:45376383-45376405 ACACACACACAGAAATATACAGG + Intergenic
954255930 3:49406085-49406107 TTCCACACACACAAAAAAACAGG + Intronic
954901653 3:54025339-54025361 GTGCACACAAACAAGTTGACAGG - Intergenic
955236737 3:57146073-57146095 GTGCACACACACACATACAAAGG + Intronic
955751807 3:62191081-62191103 ATGCACACACACACATGCACGGG - Intronic
956081790 3:65565100-65565122 GGGTGCACACACATATATACGGG + Intronic
956186162 3:66564137-66564159 ACACACACACACATATATACAGG + Intergenic
956317605 3:67956132-67956154 ACACACACACACAAACATACTGG - Intergenic
956723024 3:72134935-72134957 GTGCACACACACACATACACAGG + Intergenic
956978512 3:74610348-74610370 GTGCACACACACAAACTCACAGG - Intergenic
957602898 3:82360974-82360996 GGACACAGAGACAAATATACAGG - Intergenic
957615577 3:82522168-82522190 GTGGATACACACACATATTCAGG + Intergenic
958587571 3:96109660-96109682 ATGCACACACACAAATAGAGTGG - Intergenic
959129440 3:102335460-102335482 TTACACACATACAAATATACAGG - Intronic
959513389 3:107239722-107239744 GTACACACAAACATATATGCAGG - Intergenic
959593270 3:108102185-108102207 GTGCATGCACACAGATATGCAGG - Intergenic
960028576 3:113035382-113035404 ATGCACACACACAAACATCTTGG - Intergenic
960050464 3:113234346-113234368 GTGCACACATACACACACACAGG - Intronic
960201064 3:114837252-114837274 GTGCATACTCACATACATACAGG - Intronic
960381166 3:116963859-116963881 GTGCACACACATACACATGCAGG + Intronic
960554449 3:119011967-119011989 GTGTATACACACATATATATAGG + Intronic
960575878 3:119228895-119228917 GTGCGCACACACATACATGCAGG - Intronic
960688079 3:120313845-120313867 GTGCACACACCCACACATACTGG - Intergenic
961323179 3:126092525-126092547 ACACACACACACAAATATAGAGG - Intronic
961820277 3:129572327-129572349 TTGCACACACACAGATCTTCTGG - Intronic
962127734 3:132640008-132640030 ACACACACACACAAATATATAGG + Intronic
962460086 3:135603705-135603727 GCACACACACACAAACATAATGG - Intergenic
963303972 3:143629550-143629572 GCACACACACGCACATATACTGG - Intronic
963536468 3:146535251-146535273 ACACACACACACACATATACAGG + Intronic
963967986 3:151394968-151394990 CTGCACTCACACAAGTATACAGG - Intronic
965794349 3:172423739-172423761 CTCCACACACACAAACATGCAGG - Intergenic
966018512 3:175176074-175176096 ATGCACACATTCAAATAAACCGG - Intronic
966113856 3:176437208-176437230 ATACACACACACATATATATGGG + Intergenic
966499584 3:180624591-180624613 GTGAAAACACACAAAAGTACAGG - Intronic
966953247 3:184844501-184844523 TTCCACACACACAATTAAACTGG + Intronic
967140134 3:186550630-186550652 ATGCATACAAACAAATTTACTGG - Intronic
967905342 3:194494997-194495019 GTACACACACACACACACACTGG - Intronic
968866915 4:3218928-3218950 GTGCACACACACACACAGGCAGG - Intronic
969081267 4:4620287-4620309 ATACACACACACACACATACAGG - Intergenic
969236072 4:5865849-5865871 GTGCACACACACACACAGAAAGG + Intronic
969661858 4:8534890-8534912 GTGAAAACAGACAAATACACAGG - Intergenic
969698064 4:8746979-8747001 GTGCACACACATACATGTGCAGG + Intergenic
969705838 4:8790823-8790845 GTGCACACACATACACACACAGG + Intergenic
970630662 4:17940186-17940208 ATACACACACACACATATACAGG + Intronic
970926872 4:21462202-21462224 GTGAAAACACACAAATACATGGG - Intronic
970928353 4:21479582-21479604 ATGCACATACACACACATACAGG + Intronic
971579214 4:28312594-28312616 GAGCACACACACACATGTGCAGG - Intergenic
971579215 4:28312630-28312652 GAGCACACACACACATGTGCAGG - Intergenic
971579216 4:28312668-28312690 GAGCACACACACACATGTGCAGG - Intergenic
971579217 4:28312720-28312742 GAGCACACACACACATGTGCAGG - Intergenic
971579218 4:28312758-28312780 GAGCACACACACACATGTGCAGG - Intergenic
972375722 4:38468296-38468318 GTACACACACACACACAGACTGG - Intergenic
973009063 4:45048945-45048967 GCACACACACAGAAATATAGAGG - Intergenic
973099904 4:46253411-46253433 GTGCCAACATACAAATATGCAGG - Intronic
973134780 4:46693474-46693496 ATGCACACACACAATTATAAAGG + Intergenic
973673645 4:53241692-53241714 GTGCACACACACATACATGCTGG - Intronic
973838871 4:54840890-54840912 GTGCACCCACACACACACACTGG - Intergenic
974179804 4:58370010-58370032 ATGCACACATACACATATACAGG + Intergenic
974287217 4:59883948-59883970 ATGCACACACACACATATATTGG + Intergenic
974430361 4:61789295-61789317 GTGTACACACACATATATGTTGG + Intronic
974786734 4:66627149-66627171 ACGCACACACACATATATAGAGG - Intergenic
976012336 4:80505638-80505660 GTTCACACATACAACTATACAGG - Intronic
976237086 4:82909421-82909443 GTGCACACACACACACACACAGG - Intronic
977112816 4:92981200-92981222 GCACACACACACATATATATAGG - Intronic
977857040 4:101906912-101906934 ATGCACCCACAGAAATATACAGG + Intronic
977898566 4:102393062-102393084 ATGCACACACACAAACACAGAGG + Intronic
978014582 4:103726837-103726859 GTACACACAGAGAAACATACAGG - Intergenic
978064555 4:104380319-104380341 GTGTACACACACACATATATAGG - Intergenic
979407864 4:120337253-120337275 GCTCACACACACATATATAGTGG + Intergenic
980460252 4:133101481-133101503 GTATACACACACACATATACTGG - Intergenic
980613745 4:135192420-135192442 GAGCACACCCACAGTTATACAGG + Intergenic
980782301 4:137507066-137507088 ATACACACACACAAATATGGGGG + Intergenic
981036543 4:140175589-140175611 ACACACACACACAAATACACTGG + Intergenic
981108661 4:140910702-140910724 GTACACACACACACACACACTGG - Intronic
981536281 4:145803157-145803179 ATGCATACACACATATAAACAGG + Intronic
981645209 4:146991314-146991336 GTGCACACACACATACAAATTGG + Intergenic
981912473 4:149997520-149997542 GTACACACACACAATCAAACAGG + Intergenic
982023257 4:151225723-151225745 GTACACACTTACAAAAATACTGG + Intronic
982842296 4:160205342-160205364 ATGCACACACACACAAATACAGG - Intergenic
983972560 4:173892819-173892841 ATGCACACACAGAAATATAGAGG + Intergenic
984183989 4:176520180-176520202 GTGCACACACACACACACACTGG - Intergenic
984699372 4:182808644-182808666 GTGCACACACACATACACAAAGG - Intergenic
985614157 5:909595-909617 ACACACACACACAAATATAGAGG + Intronic
985795748 5:1961070-1961092 ATGCTCACACACACATATACTGG + Intergenic
985928863 5:3039756-3039778 GTGCACTCACACAAACCTAGAGG - Intergenic
986299927 5:6470526-6470548 GTGCACACACACACTTCCACAGG + Intronic
986746842 5:10752637-10752659 ATGCACACACACACACACACAGG - Intronic
987072205 5:14348697-14348719 GTACACACACATAAACATGCAGG - Intronic
987072207 5:14348777-14348799 GCGTACACACACAAACATGCAGG - Intronic
987072210 5:14348894-14348916 GCGTACACACACAAACATGCAGG - Intronic
987072213 5:14349056-14349078 GTGCATACACACAAACATGCAGG - Intronic
987072219 5:14349226-14349248 GTGTGCACACACAAACACACAGG - Intronic
987072221 5:14349306-14349328 GTGCACACACATATACACACAGG - Intronic
987159965 5:15132194-15132216 GTGCAAACACACACAGACACTGG - Intergenic
987273092 5:16333293-16333315 GTGAAAACCCACAAATATAGAGG + Intergenic
987620429 5:20333185-20333207 GGGCACACACACAGGTATATGGG + Intronic
987733690 5:21810112-21810134 CTGCACACACACACATTTACAGG - Intronic
987913073 5:24175160-24175182 ACACACACACACACATATACAGG + Intronic
987974876 5:25002011-25002033 GTATACACACACACATATAATGG - Intergenic
989153245 5:38320585-38320607 ATGCAGACACACATATACACAGG - Intronic
989742433 5:44789010-44789032 ACACACACACACAAATATAGAGG - Intergenic
989975923 5:50586964-50586986 ACACACACACACAAATAAACTGG + Intergenic
990172702 5:53071909-53071931 ATACACACACACAAACATACAGG - Intronic
990816911 5:59795899-59795921 ATGCAGACACACACATATGCAGG + Intronic
990983095 5:61619170-61619192 GTGCACACACATACACACACAGG - Intergenic
991044610 5:62209878-62209900 ATGCACACACACAAAATTAGCGG - Intergenic
991229653 5:64317158-64317180 GTGTGTACACACACATATACAGG + Intronic
991659596 5:68936684-68936706 GTGCACAAACTTAATTATACAGG - Intergenic
992231302 5:74666837-74666859 GAACACACACACATATATATAGG + Intronic
992851942 5:80819325-80819347 ATACACACACACACATATATGGG - Intronic
993100207 5:83529030-83529052 ATGTATACACACATATATACAGG + Intronic
993633186 5:90312680-90312702 ATACACACACACATATATAAGGG - Intergenic
993854547 5:93057000-93057022 ATGTACACACACATATATATAGG - Intergenic
994109795 5:95988364-95988386 ACGCACACACACACACATACCGG - Intergenic
994193163 5:96891449-96891471 ATACACACACACACATATACAGG + Intronic
994418987 5:99509041-99509063 ATGCACACACAGAAATATAGAGG + Intergenic
994495878 5:100512766-100512788 GCGCACACACACACACACACAGG + Intergenic
994564651 5:101426870-101426892 ACACACACACACAAATATTCAGG + Intergenic
994610687 5:102035342-102035364 GTGCAGACACACACACACACAGG - Intergenic
995237308 5:109843576-109843598 ATACACACACACACATATAGAGG - Intronic
995456113 5:112353867-112353889 GTGCCCAAACACAACTATGCAGG - Intronic
995766872 5:115628154-115628176 ATGCACAGACACAAAGATACAGG + Intronic
996028052 5:118672765-118672787 GTGCACACACAAAATTCTCCAGG - Intergenic
996617159 5:125455934-125455956 CTGCACACACACACAAACACAGG - Intergenic
997447728 5:133953651-133953673 GTGCACATCCACAATTCTACGGG - Intergenic
997744174 5:136284286-136284308 GTGCACATACACACATATCATGG - Intronic
997949982 5:138234760-138234782 ACACACACACACAAATATCCAGG + Intergenic
998712150 5:144838971-144838993 TTGTACACACACAAACATACAGG + Intergenic
999675703 5:153999983-154000005 GTATACACACACACATATAATGG + Intronic
1000026188 5:157361218-157361240 ATGCACACACACACAAACACAGG - Intronic
1000467639 5:161599866-161599888 GAACACAGACACACATATACGGG + Intronic
1000534459 5:162462758-162462780 GTGAACTCAAACAAATTTACAGG - Intergenic
1000673438 5:164090859-164090881 GTACACACACACACACATTCTGG + Intergenic
1001466796 5:171974460-171974482 ACACACACACACATATATACAGG + Intronic
1001550218 5:172597520-172597542 GTGCACACACACACAGACACAGG + Intergenic
1002886403 6:1299217-1299239 GTACACACGCACACACATACAGG + Intergenic
1003161534 6:3638768-3638790 GTGTACATATACACATATACTGG + Intergenic
1004205480 6:13587906-13587928 CAGCACTCACACAAACATACAGG + Intronic
1004259037 6:14091436-14091458 GTTCACACACACACACATGCAGG + Intergenic
1005160096 6:22849535-22849557 ACACACACACACACATATACAGG + Intergenic
1005218988 6:23564418-23564440 GTGAACACATACCAATATAAAGG + Intergenic
1005439537 6:25851033-25851055 TTCCACACACACAAATAAACAGG - Intronic
1005560519 6:27035583-27035605 GTTCACACACACAAAGATCAGGG - Intergenic
1005774862 6:29120079-29120101 GTACACACACACACACACACAGG - Intergenic
1006038746 6:31235640-31235662 ATACACACACAGAAATATAGAGG + Intergenic
1008142363 6:47846631-47846653 TTTCCCACACACAAGTATACAGG + Intergenic
1008325519 6:50176276-50176298 ACACACACACACACATATACTGG - Intergenic
1008791391 6:55239493-55239515 CTTCACACACACAAATGTGCAGG - Intronic
1009661953 6:66624861-66624883 GTGCACACACACACACTGACTGG + Intergenic
1009955582 6:70448599-70448621 GCGCACACACAGAAATATAGAGG + Intronic
1010520008 6:76821041-76821063 GTGCACACAGACATATAGAGTGG - Intergenic
1011214943 6:84995585-84995607 GGGCACACACACACAAATACTGG - Intergenic
1011592974 6:88988413-88988435 CAGCACACACACACATATGCTGG - Intergenic
1011614895 6:89188839-89188861 TTGCACACACACAGACATCCTGG - Intronic
1012024681 6:93973540-93973562 GTGCAGACACACAGAGACACAGG + Intergenic
1012747502 6:103112065-103112087 ATGCACACACATACATATAGAGG - Intergenic
1013205422 6:107940615-107940637 GCGCACACATACACATACACAGG + Intronic
1013396763 6:109748604-109748626 GTGCAAACAGACTAATACACTGG - Intronic
1013539197 6:111090629-111090651 GTGCACACACACACACACAAAGG + Intronic
1013796092 6:113890618-113890640 GTGTACACACATATATATACAGG + Intergenic
1015066125 6:129031107-129031129 GAACACACACATAAATATGCAGG - Intronic
1015531970 6:134229737-134229759 GGGCACACACACAAACAAAGAGG - Intronic
1015706932 6:136098164-136098186 ATACACACACACACATATACAGG + Intronic
1015870674 6:137773278-137773300 ATTCACACACACACACATACAGG + Intergenic
1017275218 6:152558900-152558922 GTGCACACAGACAATTCTCCAGG + Intronic
1017644117 6:156523361-156523383 GTGCACACACACACACACACAGG + Intergenic
1017859986 6:158387673-158387695 GTGCACACACACATACATTGTGG + Intronic
1017958594 6:159201938-159201960 GTGCACACACACTATTAAAGAGG - Intronic
1019233680 6:170590186-170590208 ACACACACACACAAATATAGAGG + Intergenic
1019601769 7:1887404-1887426 ATGCACACACACACATGCACAGG - Intronic
1019887316 7:3916645-3916667 ATGCACACACACACATACAGAGG - Intronic
1021249073 7:18302171-18302193 GTGCAAACAAACAAGTAGACTGG - Intronic
1022898971 7:34782657-34782679 ATGCACACACATCAATATAAGGG - Intronic
1023201798 7:37706134-37706156 TTACACACACACAAAAATAATGG + Intronic
1024595354 7:50929177-50929199 ACACACACACATAAATATACAGG - Intergenic
1024727102 7:52210702-52210724 GTGCACACACACACACATTTGGG - Intergenic
1024970771 7:55067911-55067933 GTGCGCAGACACACATACACAGG - Intronic
1025168862 7:56737724-56737746 GTGTACACACACATATATTTTGG + Intergenic
1026005146 7:66594457-66594479 ATACACACACAGAAATATAGAGG - Intergenic
1026130609 7:67617498-67617520 GTGCACACACACATTTAAAATGG - Intergenic
1026169037 7:67936820-67936842 GTGCACACAAATATATATTCTGG - Intergenic
1026314546 7:69216767-69216789 ATACACACACACATACATACGGG - Intergenic
1026805600 7:73427850-73427872 GTGCACACACAGGAGTAAACAGG + Intergenic
1026995175 7:74611137-74611159 GTGTACACACACATACACACAGG + Intergenic
1027810957 7:82897465-82897487 GTATACACACACAGCTATACAGG - Intronic
1028521632 7:91738080-91738102 GCGCACACACACAATACTACAGG - Intronic
1028732388 7:94166312-94166334 ATGCACACACAGAAATATAGAGG - Intergenic
1028769120 7:94595639-94595661 GTAGACACACACAAATATTTTGG - Intronic
1028830168 7:95318928-95318950 GTGCACTCACACACATACACAGG + Intronic
1029341763 7:99950763-99950785 ATGCACACACAGAAATATAGAGG + Intergenic
1030956073 7:115854487-115854509 GTGCACACATATACACATACAGG - Intergenic
1033723460 7:144086368-144086390 GTGCACACACACACAAACAGAGG + Intergenic
1033737869 7:144241920-144241942 GTACTCACATACACATATACAGG + Intergenic
1033745186 7:144309037-144309059 GTACTCACATACACATATACAGG - Intergenic
1033789937 7:144779331-144779353 ATACACACACACAATTATATAGG - Intronic
1033878728 7:145855456-145855478 ACACACACACACAAATATAGAGG - Intergenic
1033954869 7:146834422-146834444 CTACACACACGCAAATACACAGG + Intronic
1034048040 7:147950581-147950603 CTGCACAAACACAAACAGACTGG + Intronic
1034266124 7:149781663-149781685 GTGTACACACAGACACATACAGG + Intergenic
1034562362 7:151889262-151889284 GTGCACACACACACACACAGAGG - Intergenic
1035297376 7:157874957-157874979 GTGCACATACACAGAGACACAGG + Intronic
1035522941 8:290038-290060 GTGCACACAAACACACACACAGG + Intergenic
1035578779 8:726462-726484 GTGCACACACATACACACACAGG + Intronic
1035657487 8:1320820-1320842 GTGCACACACAGACACACACAGG - Intergenic
1035846362 8:2869088-2869110 ATACACACACACACATATATGGG + Intergenic
1036092267 8:5679839-5679861 GTGCACACATTCACATAGACAGG + Intergenic
1036510567 8:9396393-9396415 ATGCACACACACACATACATAGG + Intergenic
1038373989 8:27019615-27019637 ATGAACAAACACAAATATCCTGG - Intergenic
1038868838 8:31470422-31470444 ATACACACACACACATATATTGG + Intergenic
1039249553 8:35647379-35647401 ACACACACACACAAATACACAGG - Intronic
1040710185 8:50178407-50178429 GCGCACACACACACACACACAGG + Intronic
1040988572 8:53323924-53323946 ATGCATACACACAAATATAAAGG + Intergenic
1041478111 8:58287820-58287842 ATGAACACAAACAAATGTACAGG - Intergenic
1041742642 8:61173162-61173184 ATGCACACACACAAGTAGATAGG + Intronic
1042002427 8:64139929-64139951 GTGCACACACAAAAAATTAAAGG + Intergenic
1043049220 8:75363395-75363417 ATACACACACATATATATACAGG + Intergenic
1043376050 8:79651043-79651065 GTCCACACATACAAAAATACAGG - Intronic
1043719282 8:83526079-83526101 ATACACACACACATATATATAGG - Intergenic
1043910565 8:85858838-85858860 GCACACACACAGAAATATAGAGG + Intergenic
1044334135 8:90957619-90957641 ATTCACATACACATATATACTGG + Exonic
1044516880 8:93149323-93149345 ACACACACACACACATATACAGG + Intronic
1045759434 8:105586808-105586830 ATGCACACATACATATATAGTGG - Intronic
1046412018 8:113858086-113858108 ATGCACACACACACATAGATTGG + Intergenic
1046587358 8:116163905-116163927 GTGCACACACACATATACATAGG + Intergenic
1047746617 8:127849633-127849655 GCACACACACACATATGTACAGG - Intergenic
1047746623 8:127849684-127849706 GCACACACACACATATGTACAGG - Intergenic
1047746629 8:127849735-127849757 GCACACACACACATATGTACAGG - Intergenic
1047746635 8:127849786-127849808 GCACACACACACATATGTACAGG - Intergenic
1047746641 8:127849837-127849859 GCACACACACACATATGTACAGG - Intergenic
1047746645 8:127849888-127849910 GCACACACACACATATGTACAGG - Intergenic
1047746649 8:127849939-127849961 GCACACACACACATATGTACAGG - Intergenic
1047913475 8:129556173-129556195 GTACACACACACATATATAGTGG - Intergenic
1048101573 8:131357906-131357928 GCACACACACAGAAATATAGAGG - Intergenic
1048684310 8:136886155-136886177 GTGCACACACACTAATTTTGTGG - Intergenic
1048754535 8:137722465-137722487 ATGCACACACACATATATCAGGG - Intergenic
1049025994 8:139989302-139989324 GTGCACACACACACACAAGCAGG - Intronic
1049507061 8:143008463-143008485 GTGCAAACACACAGGTACACTGG + Intergenic
1049604438 8:143522615-143522637 ACACACACACACAAATATATTGG + Intronic
1050021646 9:1290902-1290924 ACACACACACACAAATATATTGG - Intergenic
1050253826 9:3773478-3773500 ATGCACATACACACACATACAGG - Intergenic
1050870984 9:10569482-10569504 ATGCATATACACAAGTATACAGG - Intronic
1051139694 9:13965066-13965088 GTGCACACACACACACATTAGGG + Intergenic
1051497069 9:17735397-17735419 ATGCACAAACACAAATATATAGG - Intronic
1051731274 9:20145627-20145649 GTGCAATTACACATATATACAGG + Intergenic
1052315118 9:27108623-27108645 GTGTAAAAACACAAACATACAGG - Intergenic
1052871861 9:33515187-33515209 GTGCACATACACAAACATCTCGG + Intergenic
1053205247 9:36180636-36180658 ACACACACACACAAATATAGAGG - Intergenic
1053650437 9:40163492-40163514 GTACTCAGACACAAATATACAGG + Intergenic
1053755300 9:41300434-41300456 GTACTCAGACACAAATATACAGG - Intergenic
1054330943 9:63755265-63755287 GTACTCAGACACAAATATACAGG + Intergenic
1054534147 9:66212711-66212733 GTACTCAGACACAAATATACAGG - Intergenic
1055178892 9:73358167-73358189 GTTCACACACACACAAATAAGGG - Intergenic
1055369146 9:75578199-75578221 GTGCACACACACCTATCTATGGG + Intergenic
1055743034 9:79410929-79410951 GTGTACACACACATACATAGTGG - Intergenic
1055762331 9:79622213-79622235 GTGCACACAAAGAAAAATAAAGG - Intronic
1056361829 9:85865957-85865979 ACACACACACACAAATACACAGG + Intergenic
1056571145 9:87816306-87816328 GTGCACACACAGAATGAAACTGG + Intergenic
1056808954 9:89749662-89749684 ATGCACACACACAAAACCACAGG + Intergenic
1056808956 9:89749686-89749708 ATGCACACACACAAAACCACAGG + Intergenic
1057037198 9:91819993-91820015 GTGCACACACAGACACACACGGG - Intronic
1057219713 9:93250170-93250192 GAACACACACACAAATACATAGG + Intronic
1057268784 9:93635626-93635648 GCGCACACACACACCTCTACTGG - Intronic
1057306888 9:93917592-93917614 ATGTACACACACAAACACACAGG - Intergenic
1057781382 9:98053637-98053659 ATACACACACACACACATACAGG + Intergenic
1058264326 9:102878781-102878803 GCGCACACACACACACACACAGG - Intergenic
1058719917 9:107754522-107754544 ATACACACACACATATATATAGG + Intergenic
1058817267 9:108695768-108695790 GCACACACACACACATACACAGG + Intergenic
1059570451 9:115428841-115428863 ATGAACACAAACAAATTTACAGG - Intergenic
1059703417 9:116797746-116797768 GTGCACAAACACAACTTTCCAGG + Intronic
1060686411 9:125617746-125617768 GTTCAGAGATACAAATATACAGG + Intronic
1061258957 9:129469128-129469150 GTCCACACACACACACACACAGG - Intergenic
1061706849 9:132459600-132459622 ATACATACACACACATATACAGG - Intronic
1062025788 9:134339916-134339938 GTGCACACTCACATACACACAGG - Intronic
1062107034 9:134761279-134761301 ATGCACTCACACAAACACACAGG + Intronic
1062136538 9:134931591-134931613 GTGCACATACACACACACACAGG - Intergenic
1062204934 9:135330861-135330883 GTGTGCACACAGAGATATACAGG + Intergenic
1202798325 9_KI270719v1_random:148182-148204 GTACTCAGACACAAATATACAGG + Intergenic
1185470510 X:379046-379068 GTGCATACACACAAACACACAGG - Intronic
1185470536 X:379459-379481 GTGCATACACACAAACACACAGG - Intronic
1185483009 X:461547-461569 ATGCACACAGACACACATACAGG - Intergenic
1185483055 X:462535-462557 GTGCACACAGACACATATACAGG - Intergenic
1185483057 X:462653-462675 GCACACACACACACATATACAGG - Intergenic
1185483062 X:462774-462796 ATGCACACACACAGACATGCAGG - Intergenic
1186138227 X:6542831-6542853 GTACACACACACATATATATGGG - Intergenic
1186254972 X:7708546-7708568 ATGCACACACACACACATATAGG + Intergenic
1186423906 X:9448585-9448607 CTGGACACACACACACATACAGG + Intergenic
1186716485 X:12257376-12257398 ATACACACACACAAACATACAGG + Intronic
1188138909 X:26524588-26524610 ATGCACTAACACAAATATACAGG + Intergenic
1188184235 X:27094169-27094191 ATACACACACATAAATACACAGG - Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1190513063 X:51193811-51193833 ATGCACACTCACACACATACTGG - Intergenic
1191789861 X:64958374-64958396 ACACACACACACACATATACAGG - Intronic
1191941621 X:66487135-66487157 GTATACACACACACATATAAAGG + Intergenic
1191949087 X:66569191-66569213 ACACACACACACAAATATAGAGG + Intergenic
1192766643 X:74146695-74146717 GTGCATACACACACATGAACTGG - Intergenic
1193543596 X:82800513-82800535 ATGCACACACACAGAAATAAAGG + Intergenic
1193651409 X:84138792-84138814 ACACACACACACAAATACACAGG - Intronic
1193668563 X:84354991-84355013 GCACACACACACACATATATAGG + Intronic
1193883818 X:86960435-86960457 GTGCACACACACACATGCCCTGG + Intergenic
1194110555 X:89828227-89828249 AGACACACACACAAAAATACAGG + Intergenic
1194651956 X:96526111-96526133 ACACACACATACAAATATACTGG - Intergenic
1194722714 X:97359437-97359459 GCACACACACACACATATATAGG - Intronic
1195413248 X:104592138-104592160 ACACACACACACACATATACGGG - Intronic
1196581229 X:117381355-117381377 ATACACACACATATATATACTGG - Intergenic
1196679937 X:118460414-118460436 ATACACACATACATATATACAGG + Intergenic
1197486479 X:127057144-127057166 ATGCACACCCAGAAATATCCAGG - Intergenic
1198511490 X:137356331-137356353 ATGTACACACACAAATTTACTGG + Intergenic
1198707384 X:139463395-139463417 GTGAAAACACACTAATACACCGG + Intergenic
1199040754 X:143112277-143112299 GCACACACACAGAAATATAGAGG - Intergenic
1199087833 X:143649452-143649474 GTGTACACACACAAAAATCAAGG + Intergenic
1199561004 X:149162114-149162136 GTGCACACACACATTTGCACTGG - Intergenic
1199998635 X:153044404-153044426 CTGCACACACACCCACATACAGG + Intergenic
1200642614 Y:5740158-5740180 GTGCACACACACACATTTAAAGG + Intronic
1201169070 Y:11239125-11239147 ACGCACACACAGAAATATAGAGG + Intergenic
1201220301 Y:11762759-11762781 CTACACACACACAAAGAAACTGG - Intergenic
1201517266 Y:14831569-14831591 GTATATACACAGAAATATACTGG - Intronic
1201665193 Y:16444654-16444676 GAGCACACATGCAAAAATACAGG - Intergenic