ID: 1181028028

View in Genome Browser
Species Human (GRCh38)
Location 22:20136942-20136964
Sequence ACCAGGGCCCAGAGCTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 296}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181028028_1181028038 11 Left 1181028028 22:20136942-20136964 CCCTGAGAGCTCTGGGCCCTGGT 0: 1
1: 1
2: 1
3: 28
4: 296
Right 1181028038 22:20136976-20136998 TGAGCTGGTCCCTGTTAGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 134
1181028028_1181028043 25 Left 1181028028 22:20136942-20136964 CCCTGAGAGCTCTGGGCCCTGGT 0: 1
1: 1
2: 1
3: 28
4: 296
Right 1181028043 22:20136990-20137012 TTAGGCAGGATCTGACCTTGGGG 0: 1
1: 0
2: 2
3: 9
4: 142
1181028028_1181028041 23 Left 1181028028 22:20136942-20136964 CCCTGAGAGCTCTGGGCCCTGGT 0: 1
1: 1
2: 1
3: 28
4: 296
Right 1181028041 22:20136988-20137010 TGTTAGGCAGGATCTGACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 158
1181028028_1181028042 24 Left 1181028028 22:20136942-20136964 CCCTGAGAGCTCTGGGCCCTGGT 0: 1
1: 1
2: 1
3: 28
4: 296
Right 1181028042 22:20136989-20137011 GTTAGGCAGGATCTGACCTTGGG No data
1181028028_1181028035 -4 Left 1181028028 22:20136942-20136964 CCCTGAGAGCTCTGGGCCCTGGT 0: 1
1: 1
2: 1
3: 28
4: 296
Right 1181028035 22:20136961-20136983 TGGTGGGTTGGCCTGTGAGCTGG 0: 1
1: 0
2: 2
3: 19
4: 235
1181028028_1181028037 7 Left 1181028028 22:20136942-20136964 CCCTGAGAGCTCTGGGCCCTGGT 0: 1
1: 1
2: 1
3: 28
4: 296
Right 1181028037 22:20136972-20136994 CCTGTGAGCTGGTCCCTGTTAGG 0: 1
1: 0
2: 1
3: 30
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181028028 Original CRISPR ACCAGGGCCCAGAGCTCTCA GGG (reversed) Intronic
900376590 1:2357528-2357550 GCCGGGGCCCAGAGCTGCCAAGG - Exonic
900416436 1:2537336-2537358 CCCAGGGCCCAGGGCTCACGTGG - Intergenic
900605241 1:3520938-3520960 GCATGGGGCCAGAGCTCTCAGGG - Intronic
900777549 1:4596041-4596063 ATCAGGGCCCAGGGCTGCCACGG + Intergenic
900859500 1:5218034-5218056 ACCAGGGACCAGACCTGTGAAGG - Intergenic
900997539 1:6130531-6130553 ACTAGGGCTCAGAGCTCGCTGGG - Intronic
901137983 1:7009932-7009954 GCCAAGGCCCAGAGCTCAAATGG - Intronic
901675102 1:10878692-10878714 AACAGGGCTCAGAGCTCTGGAGG + Intergenic
901759482 1:11461353-11461375 ACCTTGGCCCAGAACTCTCTGGG + Intergenic
901927097 1:12573147-12573169 ACCAGGGCCCAGATTACGCAGGG - Intronic
902041702 1:13497185-13497207 ACCTCGGCTCAGAGCTCTCCAGG - Intronic
902246863 1:15126554-15126576 ACCAGGGCTCTGTGCTGTCAGGG - Intergenic
903066818 1:20704297-20704319 ACCAGGGCCCTGCGCTCACATGG + Intronic
903472473 1:23596939-23596961 ACCAGGGCCCAGAAGTGCCAAGG - Intronic
903789003 1:25879995-25880017 TCCAGGGTTCAGAGCTCACAGGG - Intergenic
903851041 1:26306326-26306348 CCCAGAGCCCAGAGCTCTGGCGG + Intronic
905041350 1:34961703-34961725 GCCAGGGCACAGAGCAGTCAAGG + Intergenic
905207508 1:36351301-36351323 AGCAGAGCAGAGAGCTCTCAAGG - Intronic
905632312 1:39525468-39525490 TCCCGCTCCCAGAGCTCTCAGGG + Intronic
905832059 1:41077578-41077600 ACTAAGCCCCAGACCTCTCAAGG + Intronic
907430451 1:54408130-54408152 TCCAGGACCCAGCGCTCACAGGG + Intronic
907881131 1:58550118-58550140 ACCAGGGCCCAGACCTGCCTTGG + Intergenic
908028038 1:59971658-59971680 ACCTGGGCCTGGAGCTGTCAGGG - Intergenic
908256808 1:62309877-62309899 GCCAGTGGGCAGAGCTCTCAGGG + Intronic
908412636 1:63882375-63882397 ACCAGAGGCCAGAGCTCTAAAGG - Intronic
908809096 1:67960636-67960658 ACCAGGGCCCCATGCTCTGAAGG + Intergenic
910869352 1:91818457-91818479 ACCAGGGACCAGGGCTGGCAAGG - Intronic
915271459 1:154756534-154756556 ACCAAGGCCCTGAGCTGGCAAGG - Intronic
915285684 1:154850544-154850566 CAGAGGGCCCAGGGCTCTCACGG - Intronic
916221005 1:162445273-162445295 TCCAGGGCCAGTAGCTCTCAGGG + Intergenic
917222675 1:172748525-172748547 CCCTGGGCCCAGAGCACTCGCGG + Intergenic
918236586 1:182586287-182586309 AGGAGGGGCCACAGCTCTCATGG - Exonic
919747450 1:201017537-201017559 CCCAGAGCCCAGAGCTGTGACGG + Intronic
921347102 1:214197443-214197465 ACCAGAGCCCAGAGAACTCATGG - Intergenic
921390039 1:214607276-214607298 ACCTAGGCCCAGAGCTGTGAGGG - Intronic
1063551610 10:7039236-7039258 ATCAGGGACCTGAGCTCTCAAGG - Intergenic
1064004893 10:11691684-11691706 CTCAGGGCTCAGGGCTCTCAGGG + Intergenic
1064522268 10:16215601-16215623 ACCAGAGCCAGGAACTCTCAGGG + Intergenic
1065932818 10:30494420-30494442 GCCAGGGACCAGAGCTCTGCAGG + Intergenic
1067221622 10:44348106-44348128 TCCAGGGCATGGAGCTCTCAGGG - Intergenic
1070161709 10:73870859-73870881 ACCCTGGCCCAGATCTCTCCAGG + Intronic
1070819161 10:79344934-79344956 ACCTGGGCCCGGAGCCCTCAAGG + Intergenic
1072220089 10:93319421-93319443 AGGAGGGCCCTGAGCCCTCATGG + Intronic
1072740145 10:97904292-97904314 AGCAGGGCTCAAGGCTCTCAGGG - Intronic
1073415081 10:103374337-103374359 ACCAGGGCCCCAAGCTCCCTCGG + Intronic
1074814779 10:117135720-117135742 TCCTGGGCCCAGAGCCCACATGG + Intronic
1075206768 10:120455871-120455893 ACCTGAGCCCAGATATCTCAGGG - Intergenic
1075928360 10:126271680-126271702 ACCTGAGCCCAGAGCAGTCAAGG + Intronic
1076112857 10:127874085-127874107 GCCAGGGCCCAAAGCACTCCTGG - Intergenic
1076798958 10:132811904-132811926 AACAGGGCCCACACCCCTCATGG + Intronic
1076907339 10:133369590-133369612 CCCAGGACACAGAGCTTTCAAGG + Intronic
1077043857 11:535844-535866 AGCAGGGCCCCGGGCTCTCCCGG + Intronic
1077228530 11:1448680-1448702 AACTGGACCCAGAGCTTTCAGGG - Intronic
1077246809 11:1543733-1543755 ACCTGGGCAGAGAGCGCTCAGGG + Intergenic
1077279193 11:1734421-1734443 TCCAGGTCCCAGAGCCCTCCAGG + Exonic
1077313813 11:1906744-1906766 ACCAGTGCCGGGAGCTCACATGG - Intergenic
1078183399 11:9030862-9030884 CCCAGGGCACAGAGCTGGCAAGG + Exonic
1078421187 11:11214356-11214378 TCCAAAGCCCAGAGCTCTCCAGG - Intergenic
1079104485 11:17561507-17561529 CCCACTGCCCAGGGCTCTCAGGG + Intronic
1081555618 11:44157907-44157929 TTCAGGGCCCAGTGCTCTTAAGG + Intronic
1081847513 11:46251543-46251565 ACCAGGACACAGACCTCTCCAGG - Intergenic
1083150077 11:60786465-60786487 CCAGGGCCCCAGAGCTCTCACGG + Intronic
1083302276 11:61745403-61745425 CCCAGGGCCCAGAGCTGCCTAGG - Exonic
1083994484 11:66265444-66265466 ACCTGGCCCCAGGGCCCTCATGG - Intronic
1084761152 11:71271992-71272014 AACAGTGCCCAGAGCTTTAACGG - Intergenic
1085217150 11:74843129-74843151 TCCAGGGCACAGAGCCCTCGGGG + Exonic
1085512435 11:77095213-77095235 ACCAGGCCCCAGCCCTCTCTGGG - Intronic
1085875115 11:80397446-80397468 ACCAGGGCTCAGATGGCTCAAGG - Intergenic
1086592061 11:88526472-88526494 GCAGGGGCCCAGAGCTCTTAAGG + Intronic
1086981098 11:93198142-93198164 ACCCGGGCCCATAGCTCCCTGGG + Intergenic
1087142574 11:94779624-94779646 ACAAGTGCCCAGGGGTCTCACGG - Intronic
1089174321 11:116537353-116537375 TCCAGACCCCAGAGCTTTCAGGG + Intergenic
1089514738 11:119025316-119025338 ACCAGGATCCAGAGCTGCCAAGG + Exonic
1089668532 11:120035677-120035699 AGCAGGGCCCAAAGCCCCCATGG + Intergenic
1090211029 11:124921232-124921254 CCCAGGGCCCCGAGCTCGCCCGG - Exonic
1090838604 11:130471380-130471402 TTCAGGGCCCAGAACTCACATGG - Exonic
1091780178 12:3208595-3208617 ACCAGGACACAGAGCACACAGGG + Intronic
1092729401 12:11514572-11514594 TCCAGGGCCAAGAACACTCAGGG - Intergenic
1093072178 12:14717016-14717038 ACCAGGGGGCAGAGCTTTCTGGG - Intergenic
1093450081 12:19304694-19304716 GCCAGGGCCCAGACCTGTAAAGG + Intronic
1094323041 12:29206438-29206460 ACCATGGGGCAGGGCTCTCAGGG - Intronic
1096245721 12:49984561-49984583 CCTAGGGCCCAGTGCTCTCCAGG - Intronic
1096462913 12:51832520-51832542 ACCAGGGACCTGCGCTCTCCTGG + Intergenic
1097144489 12:56930469-56930491 ACCAGGGCCCAGAGGCCTGGGGG + Exonic
1097696823 12:62782909-62782931 ACCTGAGCCCAGAGATGTCAAGG - Intronic
1101675509 12:106913287-106913309 ACCAGGATCCAGAGCTCTCCAGG - Intergenic
1102173362 12:110858933-110858955 ACTGGAGCCCAGAGGTCTCAAGG - Intronic
1102566865 12:113802786-113802808 CTCAGGGCCCCGAGCTCTCAGGG + Intergenic
1104406107 12:128518146-128518168 ACCAGGGCCCAGAAAGCGCAGGG - Intronic
1104952321 12:132447032-132447054 TCCAGAGCCCTGAGCACTCACGG - Intergenic
1106012631 13:25839604-25839626 ACCATGCTCCAGAGCTTTCATGG - Exonic
1107113109 13:36718979-36719001 ACCAAGGCACAAAGGTCTCATGG - Intergenic
1107344692 13:39446525-39446547 ACCCTGGCCCAGTTCTCTCAGGG - Intronic
1108508820 13:51136575-51136597 AGCAGGTCCCAGAGCTCACCGGG + Intergenic
1109349934 13:61166448-61166470 CCAAGGGGCTAGAGCTCTCAGGG - Intergenic
1112652711 13:101416320-101416342 CCCAGCGCTCAGAGCTGTCATGG + Exonic
1113535611 13:111064064-111064086 CCCAGGGCCCAGGCCCCTCAGGG + Intergenic
1114519090 14:23321708-23321730 CCCAGGGCCCGGAGCTCCCGGGG - Exonic
1117724862 14:58662949-58662971 TGCAGGGCACAGAGCACTCAAGG + Intergenic
1117791203 14:59343877-59343899 ACCAGGGACCATACCTTTCATGG + Intronic
1118752315 14:68816300-68816322 ACCAAGGTCCAGGGCTCTCCTGG + Intergenic
1119810231 14:77511811-77511833 TCCAGGTCTCAGAGGTCTCAAGG - Exonic
1120822215 14:88922479-88922501 ACCAGGGCACAGACCCCTCAGGG - Intergenic
1121246648 14:92465564-92465586 AGCCGGGCCCAGAGCTCCCTCGG - Intronic
1121278581 14:92684768-92684790 AGCAGGGCCCAGACAGCTCAGGG + Intronic
1121950427 14:98166842-98166864 GCCAGCCCCGAGAGCTCTCAGGG - Intergenic
1122558280 14:102592903-102592925 AGAAGGGCCCCGAGGTCTCAGGG + Exonic
1122658993 14:103281879-103281901 ACCAGGCCACAGAGCTCTCCCGG - Intergenic
1122783748 14:104154610-104154632 ACCACTGTCCAGAGCTCTCAGGG - Intronic
1122789492 14:104178357-104178379 AGCCAGGCCCACAGCTCTCAAGG - Intronic
1124866826 15:33500512-33500534 TCCAGGGCCCTGGCCTCTCAAGG + Intronic
1125676728 15:41505990-41506012 ACCATGGCCCAGGGCTCTGCAGG + Exonic
1126163499 15:45634874-45634896 ACCAGGGCGTTGAGCGCTCACGG - Exonic
1126850934 15:52796374-52796396 ACCAGGGCCAAGAGACCTCGAGG + Intergenic
1128537841 15:68504061-68504083 ACCAGGCCCCTGAGCTCTGCAGG - Intergenic
1128656659 15:69467672-69467694 ACCAGGGGCCAGAGAGGTCAGGG - Intergenic
1128765011 15:70246092-70246114 CCCAGGGCCCAGCCCTCACAGGG + Intergenic
1128882205 15:71254254-71254276 AGCAGAGCCCAGAGCGCTGAAGG - Intronic
1129206987 15:74043226-74043248 GCCAGAGCTCAGAGCTCTCCTGG - Intronic
1130306309 15:82714249-82714271 CCCCTGCCCCAGAGCTCTCAGGG + Intergenic
1131054416 15:89367299-89367321 AGGAGGGCCGAGAGCGCTCACGG - Intergenic
1131154598 15:90067274-90067296 ACCTGGGGCCCGAGCTTTCAGGG + Exonic
1132300165 15:100770206-100770228 ACCTGGGACCAGAGCTGCCAGGG + Intergenic
1132747586 16:1443391-1443413 GCCCAGGCCCAGAGCTCCCAGGG - Intronic
1132747865 16:1444435-1444457 CTCAAGGCCCAGAGCTCTCACGG - Exonic
1133025864 16:2988716-2988738 GCAAGGGCCCTGAGCTCTCCTGG - Intergenic
1133447412 16:5874016-5874038 ACCAGGGCCCAGCATCCTCATGG + Intergenic
1135344101 16:21673408-21673430 ATCAGGACCCAGAACTCTCCTGG + Intergenic
1137852846 16:51763441-51763463 TTCAGGGCACAGAGCTCTCTAGG + Intergenic
1139588691 16:67920780-67920802 ACAAGGGAGCAGAGCTCTCTGGG - Intronic
1140397852 16:74644382-74644404 ACTAGTGTCCAAAGCTCTCAGGG + Exonic
1141064422 16:80902418-80902440 ACAAAGGCCCTGAGCTGTCAGGG - Intergenic
1141417461 16:83887257-83887279 ACCAGGGCCAACAGCTGGCACGG + Intergenic
1141983897 16:87567071-87567093 AGAAGGGCCCAGACCCCTCATGG - Intergenic
1142646314 17:1315944-1315966 CCCAGGGCACTGAGGTCTCAGGG + Intergenic
1142830501 17:2545567-2545589 ACCAGGCCCCACAGCCCACAGGG - Intergenic
1144587045 17:16493078-16493100 ACCAGAGCCCTGGGATCTCATGG + Intergenic
1145002403 17:19314501-19314523 AGAAGGGCCCAGATCACTCAGGG + Intronic
1145191082 17:20842543-20842565 ACCTAGGCCCAGAGCTGTGAGGG + Intronic
1149682499 17:58515899-58515921 GCCAGGGCCTACAGCTCTCTAGG + Intronic
1150297801 17:64023135-64023157 AGCAGGGCCCAGAGCTTTGAAGG + Intergenic
1150336807 17:64336309-64336331 CCCAGAGCCCAGAGCTGTTAAGG - Intronic
1150879658 17:69009508-69009530 ACCTGGGCCCAGATCACTCATGG + Intronic
1151288458 17:73131038-73131060 ACCAGGCAGCAGAGCTCTCACGG - Intergenic
1151552409 17:74829770-74829792 CACAGGGGCCAGAGCTCTCCAGG - Intronic
1151718971 17:75845013-75845035 AGCCTGGCCCAGAGCTCTCTGGG - Intergenic
1152631587 17:81413090-81413112 ACCAGGGTCCAGGGTTATCAGGG + Intronic
1152679002 17:81656111-81656133 ATCAGGGCCCAGAGCTGCCCAGG - Intronic
1152892207 17:82888973-82888995 ACCCGGGCTCCGAGTTCTCAGGG - Intronic
1153698100 18:7664420-7664442 TCCAGGGCCCTGTGCTCACAAGG - Intronic
1153817335 18:8801852-8801874 ACCACAGCCCAGAGCCCTCCTGG + Intronic
1155407679 18:25507182-25507204 AACAGTGCCCAGAGCTCACAAGG + Intergenic
1155712660 18:28902713-28902735 ACCAGGGCCCAGACCTCTCAGGG + Intergenic
1155982601 18:32196531-32196553 CCAAGGGCCCAAAGCTCTCAAGG - Intronic
1157519165 18:48333693-48333715 TCCTGGGCCCCAAGCTCTCAAGG - Intronic
1159780930 18:72659596-72659618 AGCAGCGCCCAAAGCACTCAAGG + Intergenic
1159937789 18:74382622-74382644 ACCAGGGCACAGGGCTCTGCTGG - Intergenic
1160995120 19:1878880-1878902 ACCTAGGCCCAGAGCTGTGAGGG - Intronic
1161707949 19:5831045-5831067 CCCAGGGCCCAGTGCCCTCCAGG + Exonic
1161710181 19:5843393-5843415 CCCAGGGCCCAGGGCCCTCCAGG + Exonic
1161719291 19:5894342-5894364 ACCAGAGCCCACAGCGCTGAGGG + Intronic
1163366763 19:16879839-16879861 GCCAGGGCCAGGGGCTCTCATGG - Exonic
1163731039 19:18949285-18949307 CCCAGGACCCAGGCCTCTCAGGG + Intergenic
1163741503 19:19016442-19016464 ACCAGCCCCCAGGCCTCTCAGGG + Intronic
1164741428 19:30578785-30578807 ACCAGGCCATAGGGCTCTCATGG + Intronic
1165307861 19:35013265-35013287 ACCAGGTGCCAGAGCTCGCGGGG - Exonic
1165358852 19:35321104-35321126 GCCAGGTCCCAAAGGTCTCAGGG - Intronic
1165925491 19:39323593-39323615 AGCTGGGACCAGAGCTCACAGGG - Intergenic
1166553750 19:43684444-43684466 ACCAGGGCTCACAGCAGTCAAGG - Intergenic
1166628904 19:44387754-44387776 ACCGAGCCCCAGAACTCTCAGGG - Exonic
1166638345 19:44471927-44471949 ACCGAGCCCCAGAACTCTCAGGG + Intergenic
1167357724 19:49014494-49014516 ACCAGCTACCAGAGCCCTCACGG + Exonic
1168659512 19:58155011-58155033 AACGGGGCCGAGTGCTCTCAGGG - Intronic
925278158 2:2665184-2665206 GCCAGGGCCCAGGGCTCTGCAGG - Intergenic
925916954 2:8613838-8613860 ACCAAGGCACAGAGATGTCAAGG - Intergenic
927883293 2:26703928-26703950 ACCAGAGTCCAGAGCCCTCCAGG - Intronic
930053780 2:47236762-47236784 CCCAGGTCCCAGAGCTGGCAAGG + Intergenic
934553593 2:95276379-95276401 GCCCGGGCCCAGTGCTCACAGGG - Intronic
935589176 2:104830049-104830071 AACAGGACCTAGAGCTCTCACGG + Intergenic
936537796 2:113325177-113325199 ACCAGAGCCCACGGCGCTCACGG + Intergenic
937454087 2:122026309-122026331 ACAGGGGCCCAGAGCACACATGG + Intergenic
938382548 2:130844652-130844674 CCCAGGGCACAGAGCTCTATGGG - Intronic
938696540 2:133840288-133840310 CCAAGAGCCCAGAGCTCCCAAGG - Intergenic
939234597 2:139475212-139475234 ACCAGGAACCATGGCTCTCATGG + Intergenic
939869818 2:147514614-147514636 AGCAGGGCTGAGAGCTCTCTGGG - Intergenic
942090011 2:172480567-172480589 ACCAGGTCTCTGACCTCTCAGGG - Intronic
946024904 2:216665790-216665812 TCCAGTGCCCAGAGCCCTCTAGG - Intergenic
946902268 2:224384075-224384097 ACCAGTGCCGAGACATCTCAGGG + Intronic
947017714 2:225639854-225639876 ACCTGGGGACTGAGCTCTCAAGG + Intronic
947505658 2:230706533-230706555 ATGAGGGCCCACAGATCTCAGGG - Intergenic
947857370 2:233333270-233333292 ACCAGGGCCAAGACCCCTCCAGG - Intronic
948338125 2:237227164-237227186 ACAAGGGCTCAGACCCCTCAGGG + Intergenic
948629710 2:239294261-239294283 ACCTGGGCACAGAACACTCAGGG + Intronic
948631649 2:239306700-239306722 TCCAGGGCCCAGGGCCCACAGGG + Intronic
948668106 2:239548862-239548884 AGCAGGGCCCATTTCTCTCAGGG - Intergenic
948698926 2:239748551-239748573 ACCAGGGCTCAGAGCTTTGGGGG - Intergenic
948835717 2:240625117-240625139 CCCAGGGCCCAGCCCTCCCAGGG - Intronic
949034912 2:241811890-241811912 GCCAGGGCCCAGGACGCTCACGG + Intronic
1170694120 20:18642773-18642795 ACCAGGGGCAAGATCTCTGAGGG - Intronic
1171168501 20:22994416-22994438 CCCATGGCTCAGAGATCTCATGG - Intergenic
1171372501 20:24670644-24670666 ACCCGTGCCCAGGGCTCCCAGGG + Intergenic
1172134863 20:32680066-32680088 ACCAAGGCCCAGAGTTCTGCAGG - Intergenic
1172414032 20:34749803-34749825 ACCAGGGCCCAGCCCACACATGG - Exonic
1172869293 20:38125866-38125888 ACCATGTTCCAGGGCTCTCAGGG - Intronic
1173849250 20:46207476-46207498 GCCTGGGCCCAGACCTCTCCAGG - Intronic
1175690977 20:61065863-61065885 CCCAGGGCCCGGCGCCCTCAAGG + Intergenic
1176040010 20:63060396-63060418 TCCGGCGCCCAGAGCTCACAGGG + Intergenic
1179552860 21:42154508-42154530 ACCAAGGCTCAGGGCTCCCAGGG - Intergenic
1180055692 21:45358133-45358155 CCCAGGGACCAGGGCACTCAGGG + Intergenic
1181028028 22:20136942-20136964 ACCAGGGCCCAGAGCTCTCAGGG - Intronic
1181121184 22:20669418-20669440 ACCTAGGCCCAGAGCTGTGAGGG - Intergenic
1181181692 22:21073052-21073074 ACCAGGTCACAGAGCAGTCAAGG - Intergenic
1181334144 22:22116444-22116466 ACCTAGGCCCAGAGCTGTGAGGG - Intergenic
1181339793 22:22168731-22168753 ACCAGAAACCTGAGCTCTCAAGG + Intergenic
1181537769 22:23555584-23555606 TCCAGGGCCCACAGATGTCAGGG - Intergenic
1181541241 22:23574327-23574349 ACCAGGCCCCAGAGATGACAGGG + Intronic
1182004856 22:26951418-26951440 AGCAAGGACCAGAGGTCTCATGG + Intergenic
1184693997 22:46129830-46129852 CCCAGGGACCAGAGCAGTCAGGG - Intergenic
1184863922 22:47192245-47192267 CGCAGGGCCCAGAGCACGCAGGG - Intergenic
949282438 3:2362159-2362181 GGCAGGGCCCAGATCTATCAGGG + Intronic
950421439 3:12901940-12901962 AACAGGGCCCTCAGCTCTCCTGG + Intronic
950664563 3:14487455-14487477 ACCAGAGTCATGAGCTCTCATGG - Exonic
950678030 3:14566292-14566314 ACAAGGCCACAGAGCTCCCAGGG + Intergenic
952823718 3:37507153-37507175 ACCAGGGCCCTGAGCTGGCAGGG + Intronic
953492665 3:43364175-43364197 TCCCAGGCCCAGAGCTCTCCCGG - Intronic
954130896 3:48560398-48560420 CCCTGGGCCCAGGGCTCACAAGG + Intronic
954280179 3:49571618-49571640 GCCAGGCCCCAGAGGCCTCAGGG + Intronic
954827159 3:53384061-53384083 ACCTGGACCCAGAGATGTCATGG + Intergenic
955016690 3:55077194-55077216 ACCAGGGTCCAGAGCCCTCCAGG - Intergenic
956853930 3:73257427-73257449 ACAAGGGCCAAGACCTGTCATGG - Intergenic
957415586 3:79898787-79898809 ACCAGGGCTCAGAGAACTTACGG + Intergenic
958961718 3:100516963-100516985 ATGCGGGCCCAGAGCTCTCTGGG - Intronic
960011329 3:112836516-112836538 ACCAGGCCTCAGACCACTCAGGG + Intronic
961004201 3:123393749-123393771 CCCAGGGCCCAGGGATGTCAGGG - Intronic
961368235 3:126414741-126414763 CTCAGGGCTCACAGCTCTCAGGG - Intronic
961653056 3:128426778-128426800 ACCCGGGGCCAGCGCTCTCCCGG - Intergenic
963057896 3:141202174-141202196 ACCATGGCCCAGAGGTCTATTGG + Intergenic
963300561 3:143592786-143592808 ACCAGGGCTCAGCTCTCTCCAGG + Intronic
964283808 3:155096129-155096151 ACCAGGGCCCAGGTCACACAGGG + Intronic
966677991 3:182609926-182609948 ACCTGTGCCCAGATCACTCAGGG - Intergenic
966854398 3:184184235-184184257 ACCTGGGCCCAGAACCCACAAGG - Intronic
966927814 3:184656991-184657013 GCCAGGGCCAAGAGCCCCCAGGG - Intronic
967143883 3:186589385-186589407 TCCAGAGCCGATAGCTCTCACGG - Intronic
967304213 3:188045186-188045208 ACCAGAGCCCAGATCTCTACTGG - Intergenic
968522820 4:1041821-1041843 AGCACGGCCCAGAGCATTCAAGG - Intergenic
968690749 4:1988564-1988586 GCCAGGGCCCAGCGCTGTCCGGG - Intronic
969124613 4:4937363-4937385 AACAGGAGCCAGAGGTCTCATGG + Intergenic
969342269 4:6549622-6549644 ATCAGAGCCCACTGCTCTCAGGG - Intronic
970213570 4:13735579-13735601 ACCAAGGCCCAGAGGTGTCCAGG - Intergenic
971505068 4:27357876-27357898 AATGGGGCCCAGAGCTCACATGG + Intergenic
973678191 4:53287045-53287067 GTCAGGGCACAGAGCTGTCATGG - Intronic
982485459 4:155959791-155959813 TCCAGGGCTCAAAGCTGTCAAGG + Intergenic
987085134 5:14461087-14461109 ATCGGGGCCCAGAGCTCGCCGGG + Exonic
987449943 5:18070732-18070754 ATCAAGGCCCAGAACTATCAAGG + Intergenic
990333219 5:54747584-54747606 TCCAGGGCCCAGCGTTCTCCTGG + Intergenic
990616284 5:57511704-57511726 CCCAGGTCACAGAGCTCACATGG - Intergenic
991419338 5:66425710-66425732 ACCAGGGCCCAGAGGCTTCCTGG + Intergenic
996581086 5:125033121-125033143 AGCAGGGCCATGATCTCTCAGGG + Intergenic
997352863 5:133243586-133243608 GCCCTGGCCCAGAGCTCTCTGGG - Intronic
997744483 5:136287233-136287255 ACCAGAACACAGAGCTCTCCTGG - Intronic
997977682 5:138449828-138449850 ACCATGGCTCAGAGCCCCCAAGG - Intergenic
998325902 5:141279648-141279670 ACCAGGGCTCAGGTCTCTCAGGG + Intergenic
998681693 5:144474695-144474717 GCCAGGGCCTAGACCTCCCAAGG + Exonic
1002994515 6:2270225-2270247 CCCAGGGCCCAGGCCTCTCCTGG - Intergenic
1005360258 6:25024446-25024468 ACCATAGGCCAGAACTCTCATGG + Intronic
1005719794 6:28590035-28590057 ACCAGGGACCCGAGCCCTCCGGG - Intronic
1007077110 6:39075003-39075025 ACCAAGGCCCAGAGCTGGCAGGG + Intronic
1007178115 6:39910057-39910079 ACCAGGGCCCAGGCCTCCCATGG + Intronic
1007808882 6:44472524-44472546 GCCTGGGCCCAGAGCCCACACGG + Intergenic
1009197849 6:60708879-60708901 ACCAGGGTCTAGAGATTTCAAGG + Intergenic
1010083370 6:71887942-71887964 AACAGGCCCCAGAGGTCTCTTGG - Intronic
1018264391 6:162006666-162006688 ACCAGGGGGCAGAGCTCTCTCGG - Intronic
1019389669 7:779003-779025 CTCAGGGCCCAGAACCCTCAGGG + Intronic
1019920190 7:4158323-4158345 ACAGGAGCCCAGAGCTCTCAGGG + Intronic
1019924976 7:4185974-4185996 TCCAGGGCCCAGGGAGCTCAGGG + Intronic
1020014187 7:4821323-4821345 ACTGGGGGCCAGACCTCTCATGG - Intronic
1021799964 7:24295414-24295436 AACAGAGGCCAGAGGTCTCATGG + Intergenic
1022116368 7:27264601-27264623 GCCAGTGCCCAGGGCACTCAGGG + Intergenic
1022383400 7:29881636-29881658 ACCTTGGCCTAGAGCTCTAAGGG + Intronic
1022815671 7:33912064-33912086 ACCAGGGCCCAAAGATCACTGGG - Intronic
1023394712 7:39742305-39742327 ACCATGGGCAAGAGCTTTCAAGG + Intergenic
1023757510 7:43433378-43433400 ACCAGTGCCCTGCTCTCTCAAGG + Intronic
1023833371 7:44053202-44053224 ACCAGGGCCCACCCTTCTCACGG - Intronic
1026291259 7:69008101-69008123 ACCAGGCCCCAGAGAACCCAGGG - Intergenic
1026889772 7:73975046-73975068 AGGAGGGCCCAGAGCTCTGGTGG - Intergenic
1027136364 7:75627138-75627160 ATCAGGGTCCAGTGCACTCAAGG + Intronic
1029306915 7:99626324-99626346 ACAAGGACCCAGAGTCCTCACGG - Intronic
1030183889 7:106740087-106740109 AACAGGGCCCAGGGCTCAAAAGG + Intergenic
1031574176 7:123395696-123395718 ATCAGGGCCCAAGGCTCTAAGGG - Intergenic
1032001023 7:128265406-128265428 ACCCAGCCCCAGAGCTCTCTGGG + Intergenic
1032220603 7:129991242-129991264 ACCAGGACACAGAGCTCTTGGGG + Intergenic
1036969088 8:13334128-13334150 ACCAGGGACGTCAGCTCTCATGG + Intronic
1036987140 8:13546624-13546646 ACCAGGGCCCTCTGCTCTCTTGG + Intergenic
1038115873 8:24554606-24554628 ACCAGGACCCAGAGTTTCCAGGG + Intergenic
1038615524 8:29090386-29090408 TCCAGTGCCCAGAGCTCCAACGG - Intronic
1039434085 8:37547638-37547660 ACAAGAGCCCACAGCTCCCAGGG - Intergenic
1039644305 8:39263708-39263730 ACCAGTGCCCAGAGCTCGAGTGG - Intronic
1039911131 8:41828080-41828102 CCCAGGGCCGCGAGCGCTCAGGG + Intronic
1040580745 8:48696636-48696658 GCCAGGGCCCAGAGTGCACATGG + Intergenic
1041678472 8:60561446-60561468 ACCAGAGCTCAGAGCTCTTAAGG + Intronic
1047186442 8:122637353-122637375 GGCAGGACCCAGAGCTCTCTGGG - Intergenic
1049005094 8:139849975-139849997 ACCAGTGACCAGACCTCCCAGGG + Intronic
1051065626 9:13098996-13099018 CTCAGGGCCCTGAGCTCTGAAGG + Intergenic
1053119662 9:35537258-35537280 CCCTGGGCCCAGAGCTCTCATGG + Intronic
1056848682 9:90062453-90062475 ACCAGGGACCAGACAACTCAAGG + Intergenic
1057951076 9:99369489-99369511 ACCCTGGCCCTGCGCTCTCATGG + Intergenic
1059930832 9:119258857-119258879 ACCAAGGCCCAGAGCAGTGAAGG + Intronic
1060208097 9:121694229-121694251 CCCAGGGGCCAGAACTCTCTTGG + Intronic
1060230965 9:121824960-121824982 CCCAAGGCCAAGAGCTCTGATGG - Intronic
1061232125 9:129321188-129321210 GCCAGGGCCAAGGGCTCCCAGGG - Intergenic
1061392813 9:130327237-130327259 CCCATGGCCCAGGGCGCTCATGG + Intronic
1062023962 9:134332015-134332037 CCCAGGGCACAGAGCTGGCATGG - Intronic
1062085601 9:134646477-134646499 ACCGTGTCCCAGAGCTCTCCTGG + Intronic
1062217874 9:135398980-135399002 ACCAGAGCCCACAGCTCCCCGGG - Intergenic
1062324421 9:136005336-136005358 AGCAGAGCCCCCAGCTCTCAGGG - Intergenic
1062699591 9:137891965-137891987 ACCAGGCTCCTGTGCTCTCAGGG - Intronic
1062713381 9:137988907-137988929 ACCAGGGTCCTGAGATCCCAGGG + Intronic
1185839428 X:3374984-3375006 ACTGGGGCCCAGACCACTCAAGG + Intergenic
1186482394 X:9905883-9905905 AACAGGGCACAGAGCTCTGCTGG - Intronic
1187484195 X:19686576-19686598 ACCAGGGCACAGAGCAATCTAGG + Intronic
1189337968 X:40182274-40182296 GGCAGGGCCCAGGGCTCTCCAGG - Intergenic
1189359790 X:40341059-40341081 ACCAGGGCTCAGACCCTTCAAGG - Intergenic
1195021455 X:100832833-100832855 ACCCGAGCCCAGACCTCTAATGG + Exonic
1195673497 X:107488359-107488381 ACCAGGGCCCAGATCTTGCAGGG + Intergenic
1198679395 X:139165548-139165570 TCAGGGGCCCAGAGCTCTCAAGG + Intronic
1198788575 X:140317652-140317674 ACTAGGGGGCAGAGGTCTCAGGG - Intergenic
1200136674 X:153878623-153878645 ACCAGTGCTCAGAGCTCCCAAGG - Intronic