ID: 1181029291

View in Genome Browser
Species Human (GRCh38)
Location 22:20142211-20142233
Sequence GGCCAAGGGTCTGAGTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 255}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181029285_1181029291 21 Left 1181029285 22:20142167-20142189 CCTGGAGAGAGTCACTGGGTGAA 0: 1
1: 0
2: 1
3: 20
4: 179
Right 1181029291 22:20142211-20142233 GGCCAAGGGTCTGAGTCTGCAGG 0: 1
1: 0
2: 1
3: 24
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181029291 Original CRISPR GGCCAAGGGTCTGAGTCTGC AGG Intronic
901005493 1:6169867-6169889 GGCAGAGGGTCTGAGGCTGAGGG - Intronic
901221110 1:7584327-7584349 GGCCAAGGGTCGGGGGCTTCCGG + Intronic
903067393 1:20708219-20708241 GGCCATGAGTCTGAGTGTCCCGG - Intronic
903318543 1:22527578-22527600 TGCCAAAGGTTGGAGTCTGCTGG + Exonic
904374044 1:30068614-30068636 GGGGAGGGGTCTGGGTCTGCAGG + Intergenic
904434397 1:30484900-30484922 GGCCTATGGTCTGGGTCTCCAGG + Intergenic
905892850 1:41528061-41528083 GGGCAAGGGTATGAGTGTGAAGG - Intronic
906538095 1:46563088-46563110 GGCCAAGGGTCTTTGCCTACTGG - Intronic
906947223 1:50305333-50305355 TTCCAAGGGTCTCAGTCTGAAGG - Intergenic
908383502 1:63618730-63618752 GGCCAAGGGTCTGGATGTGGAGG + Intronic
909165724 1:72221951-72221973 GGCCTAGGGACTGAGTCTTGGGG - Intronic
911041128 1:93591896-93591918 TGCAAATGGTCTGAGGCTGCTGG + Intronic
911309755 1:96277965-96277987 GGCCTGGAGTCTGAGTCTCCAGG + Intergenic
913366674 1:118047430-118047452 GGCCTAGAGCCTGAGTCTGCAGG - Intronic
913691764 1:121286321-121286343 GCCCAAGAGTTTGAGGCTGCAGG - Intronic
914145780 1:144993633-144993655 GCCCAAGAGTTTGAGGCTGCAGG + Intronic
915324797 1:155075886-155075908 GCCCAAGAGTCAGAGCCTGCAGG + Intergenic
916403009 1:164469163-164469185 GGCAAAGAGTCTTAATCTGCAGG - Intergenic
918603948 1:186399280-186399302 GCCCAAGAGGCTGAGGCTGCAGG - Intronic
919943990 1:202306818-202306840 GAGCCAGGGTCTGAGCCTGCCGG + Intronic
920305209 1:205014231-205014253 GACCCAGGGTCAGTGTCTGCGGG - Intronic
920312666 1:205057880-205057902 GGCCAAGGCTCTGAGGCATCTGG + Intronic
920479096 1:206304831-206304853 GCCCAAGAGTTTGAGGCTGCAGG - Intronic
922359733 1:224810489-224810511 GGCCTGGGGCCTGAGGCTGCTGG - Intergenic
922375985 1:224966761-224966783 GCCCAAGAGTTTGAGGCTGCAGG - Intronic
922445698 1:225695220-225695242 GCCCAAGAGTTTGAGGCTGCAGG + Intergenic
922549343 1:226482568-226482590 GGACTGGGGTCTGAGTCTGGGGG + Intergenic
923449843 1:234106253-234106275 AGCCAAGGGTAAGTGTCTGCTGG + Intronic
923744995 1:236692075-236692097 GGACAAGGGCCTGAGGCTGGGGG + Intronic
1065116350 10:22486972-22486994 GCCCAAGAGTTTGAGGCTGCAGG - Intergenic
1068464971 10:57377828-57377850 GGCCAAGGGGTTCAGTCTCCAGG + Intergenic
1068924314 10:62519146-62519168 GGCCAAGGGTCTAATACTCCAGG + Intronic
1069604020 10:69728786-69728808 TGCCAAGGCTCTGAGTCAGGAGG - Intergenic
1069970834 10:72167711-72167733 GGCCAGGAGTTTGAGGCTGCAGG - Intronic
1071236714 10:83657734-83657756 GGCCTGGGGCCTAAGTCTGCAGG + Intergenic
1071604563 10:86976160-86976182 GGCCAGGAGTTTGAGGCTGCAGG - Intronic
1073296180 10:102440264-102440286 GCCCAAGAGTGTGAGGCTGCAGG + Intergenic
1073553992 10:104429969-104429991 AGCCAAGGGAATGACTCTGCAGG - Intronic
1073592780 10:104772252-104772274 GGGCAAGGATCTGCATCTGCAGG + Intronic
1074360333 10:112820456-112820478 TGCCACTGGTCTGAGTCTGATGG - Intergenic
1074415164 10:113261242-113261264 GGCACAGGGCCTGCGTCTGCAGG - Intergenic
1074433538 10:113414478-113414500 CGCCAATGGTCAGAGTTTGCTGG - Intergenic
1074531273 10:114300494-114300516 GGACCTGGGCCTGAGTCTGCCGG + Exonic
1075762709 10:124869121-124869143 GGCAAAGGGGCAGAGTCTGAGGG - Intergenic
1076151799 10:128168637-128168659 GGCCAGGAGTTTGAGACTGCAGG - Intergenic
1076230040 10:128812451-128812473 GGCCAAGTGTGTGATTCTTCTGG - Intergenic
1076562304 10:131375188-131375210 TGCCAAGGGCCTGGGGCTGCAGG - Intergenic
1077076608 11:705188-705210 GGCCAAGAGTCTGGGTCCCCGGG - Intronic
1077130852 11:971734-971756 GGCCACGCGTCTGAGTGTTCCGG - Intronic
1078019067 11:7640375-7640397 GGGCAAGGGTGTCGGTCTGCAGG + Intronic
1078604477 11:12762980-12763002 GGCCAAGGGCCTGAGTAGGGAGG - Intronic
1079185117 11:18229798-18229820 GGCCAAGGGTCTGAAAATGTAGG - Intronic
1080388367 11:31823556-31823578 GTCCCCGGGTCTGAGGCTGCTGG + Intronic
1082124893 11:48420804-48420826 GACCAAGGGTATGAGTGTCCAGG - Intergenic
1082695797 11:56363072-56363094 GGCCAGGAGACTCAGTCTGCAGG - Intergenic
1082962627 11:58934100-58934122 AGCATAGTGTCTGAGTCTGCTGG + Intronic
1082976266 11:59076176-59076198 GGCCTAGTGTCTGGGTCTACTGG + Intergenic
1083887135 11:65578375-65578397 GTCCAAGGGTCTGCGGCTGGAGG - Intronic
1083938224 11:65881444-65881466 GGCCCAGGCTCAGAGGCTGCAGG + Exonic
1084704323 11:70806987-70807009 GGTCAAAGGTCAGTGTCTGCTGG - Intronic
1086103937 11:83129212-83129234 GGCCTGGAGCCTGAGTCTGCAGG - Intergenic
1086426550 11:86689399-86689421 GGCCAGGTCTCTGGGTCTGCTGG - Intergenic
1089201532 11:116727409-116727431 GGCCTGGGGTCTGAGTTTGAGGG - Intergenic
1089702915 11:120256052-120256074 GACGAAGGGTCTGAATCTGAGGG + Intronic
1094192650 12:27712727-27712749 TGCCAAGGGGCTGAGTGTGGGGG + Intronic
1094367282 12:29697680-29697702 GCCCCAGGGTCTGAGTGTGAAGG + Intronic
1094502849 12:31036189-31036211 GGGTGGGGGTCTGAGTCTGCAGG - Intergenic
1098414250 12:70215039-70215061 GGACTAGAGCCTGAGTCTGCAGG + Intergenic
1101362866 12:104044143-104044165 GGCCAAGGCTCTGAGGCAGGAGG - Intronic
1102016045 12:109648649-109648671 GGCCCAGGGTCAGAGGCTGACGG + Intergenic
1103139441 12:118535817-118535839 GGCCAGGAGTTTGAGGCTGCAGG + Intergenic
1103197436 12:119057103-119057125 GACCAAGTGTCTGAGGATGCGGG - Intronic
1103962909 12:124620652-124620674 GTCCAGGAGTCTGAGGCTGCAGG - Intergenic
1105000820 12:132688371-132688393 GGCCAAGGGAGCGAGTCTGCGGG + Intronic
1105000857 12:132688488-132688510 GGCCAAGGGAGCGGGTCTGCGGG + Intronic
1105000869 12:132688527-132688549 GGCCAAGGGAGCGGGTCTGCGGG + Intronic
1105001003 12:132688956-132688978 GGCCAAGGGAGCGAGTCTGCGGG + Intronic
1105001040 12:132689073-132689095 GGCCAAGGGAGCGGGTCTGCGGG + Intronic
1105001052 12:132689112-132689134 GGCCAAGGGAGCGGGTCTGCGGG + Intronic
1105001095 12:132689268-132689290 GGCCAAGGGAGCGAGTCTGCGGG + Intronic
1110582184 13:77143477-77143499 GGCCAAAGGTCTGAGAATCCAGG - Intronic
1113936233 13:113996461-113996483 GGCCAAGGGGCTGAGTAGGGAGG - Intronic
1116432909 14:44866961-44866983 GGCCTTGGGTCTGGGGCTGCAGG + Intergenic
1119953946 14:78774844-78774866 AGCCAAGGGTTTGAGGCTACAGG + Intronic
1120240009 14:81939029-81939051 GGCCAAGGTTCTGAATTTGAAGG - Intergenic
1120953325 14:90061601-90061623 GGACACGGGTGTCAGTCTGCTGG - Intergenic
1121096184 14:91219670-91219692 GGCCAAGGGCCAGAGTGGGCAGG - Intronic
1121657130 14:95605341-95605363 GGCGAAGGGTGTGAGTCGGAAGG - Intergenic
1122119169 14:99542718-99542740 GGCCAAGGGTTAGTGCCTGCTGG - Intronic
1122772047 14:104101883-104101905 GGGTAAGGGGCTGAGCCTGCAGG + Intronic
1123023326 14:105412192-105412214 AGCCAAGGAGCTGAGTCTCCAGG - Exonic
1124121652 15:26893716-26893738 GGGCGAGGGGCTGAGTCTGGGGG + Intronic
1124235166 15:27983855-27983877 GGGAAAGGGGCTGAGTCAGCAGG - Intronic
1125522259 15:40354811-40354833 GGCCTAGGAACTGAGTCTGCTGG - Intronic
1125653041 15:41333017-41333039 AGCCAAGAGTCTGGGTCTCCGGG + Exonic
1127246678 15:57184098-57184120 GGACAAAGGACTAAGTCTGCAGG - Intronic
1127783929 15:62339748-62339770 GGAAAAGGGTATGAGCCTGCGGG - Intergenic
1129105081 15:73301503-73301525 GCCCCAGGGCCTGAGACTGCTGG + Intronic
1129332444 15:74834589-74834611 GGCCTGGGGACTGAGGCTGCTGG - Intergenic
1130014233 15:80174891-80174913 GGCAGAGGGTCTGAGACAGCAGG - Intronic
1131711624 15:95062100-95062122 GGCCAAGTTTCTCAGTCTGCTGG + Intergenic
1131844450 15:96473639-96473661 GGGCAAGGTTCTCATTCTGCGGG + Intergenic
1132324943 15:100961175-100961197 GGCAAAGGGCCTGAGTGTGCTGG + Intronic
1132607589 16:800044-800066 GGCCCAGGGCCTGAGGCTGGTGG + Intronic
1133012850 16:2924586-2924608 GGCCAGGGCCCTGAGTCTGCAGG - Intronic
1134431269 16:14209140-14209162 GGCCACGTGCCTGCGTCTGCAGG + Intronic
1134490335 16:14691399-14691421 GGCCCTGAGTCTGAGTCTGGAGG - Intronic
1134495716 16:14730516-14730538 GGCCCTGAGTCTGAGTCTGGAGG - Intronic
1134844664 16:17429806-17429828 GGCCAAGGGTCTGAGAATCAAGG - Intronic
1135536750 16:23300753-23300775 GCCCAAGAGTTTGAGGCTGCAGG + Intronic
1135931488 16:26741662-26741684 GGCCAGGAGTTTGAGGCTGCTGG - Intergenic
1136028272 16:27484080-27484102 GGCCAAGTGTTGGAGTCTGCTGG - Intronic
1136234481 16:28905459-28905481 GGCCAAGGTGCTGCGGCTGCAGG - Exonic
1137893121 16:52183123-52183145 GGCAAAGTCTCTGAGACTGCAGG - Intergenic
1139274176 16:65711954-65711976 GGCCAAGGGTCAGGGATTGCTGG + Intergenic
1140179609 16:72701522-72701544 GCCCAAGGTACTGAGACTGCAGG + Intergenic
1141033024 16:80606242-80606264 GGCCATGGGCCTTACTCTGCTGG + Intronic
1142012234 16:87721459-87721481 GGCCACAGGTCTGCGTGTGCTGG + Intronic
1142396923 16:89837345-89837367 GGCCCAGGGTCAGACTCAGCTGG + Intronic
1142408422 16:89903917-89903939 TGCCCAGGGTCTGAGGCTGGGGG - Intronic
1143714529 17:8757451-8757473 GGCCAAGGGATTGAGGCTGGGGG + Exonic
1145943965 17:28759367-28759389 GGCCCAGGCCCTGAGGCTGCTGG + Exonic
1146457666 17:33020015-33020037 GGCCAAGGGAATGAGTCTCTTGG + Intronic
1147256323 17:39184507-39184529 GGGCGGGGGTCTGAGTCTGAGGG + Intronic
1147553435 17:41461237-41461259 GGGCATGGGTCTGTGGCTGCTGG - Intronic
1148871093 17:50659155-50659177 AGCCAAGGGTCAGTGTCTCCAGG - Intronic
1149107881 17:52991275-52991297 GGTCAAGGGTCTAAGTTAGCTGG + Intergenic
1150136934 17:62701255-62701277 GGCCAAGGGTCTCAAGCTGGAGG - Intergenic
1150540186 17:66088827-66088849 GGCCAGGGGCCTGAGTGTGCAGG - Intronic
1150703758 17:67469549-67469571 GGCCGCTGGTCTGAGTGTGCTGG - Intronic
1152171582 17:78753374-78753396 GGCCAAGAGCATGAGTCTTCTGG - Intronic
1152242738 17:79168725-79168747 GACCATGGCTCTGTGTCTGCCGG - Intronic
1152331985 17:79678811-79678833 GGCCGAGGGTGGGAGGCTGCAGG - Intergenic
1153167502 18:2279516-2279538 GGCCAAGCTGCAGAGTCTGCTGG - Intergenic
1154383779 18:13875465-13875487 GCCCAAGGGTCTCAGGCGGCTGG + Intergenic
1155123122 18:22842951-22842973 GGCCAAGGGTCTTAATCTGGGGG - Intronic
1155161161 18:23196882-23196904 AGCCCAGGCTCTCAGTCTGCGGG + Intronic
1158697696 18:59717484-59717506 GGCCAAAGGCCTGAGAATGCAGG + Intergenic
1163112509 19:15170142-15170164 GGCCAAGGGTGAGAGCCTGATGG - Exonic
1163516500 19:17767155-17767177 GCCCAAGTGTTTGAGGCTGCAGG - Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1164676117 19:30102892-30102914 TTCCAAGGGTCTGGATCTGCGGG + Intergenic
1165828669 19:38719819-38719841 GGCCAAGGGGCTGGGTGTGGTGG + Intronic
925897180 2:8481537-8481559 GGCCATGTGGCTGAGTCTGATGG - Intergenic
926146474 2:10399641-10399663 GGCCAATGGTGTGAATGTGCTGG - Intronic
927944696 2:27128569-27128591 GGACTAGGGGCTGAGACTGCAGG - Exonic
928933589 2:36650300-36650322 GGCCAAGGGTCGGTGCCTGAAGG - Intergenic
929301097 2:40304532-40304554 GGCCAAAGCTCTGAGACTGCGGG - Intronic
932147590 2:69336710-69336732 GCCCATGAGTCTGAGGCTGCAGG + Intronic
932588008 2:73044371-73044393 GGCCGAGGGGCTGAGGCTCCAGG + Intronic
934855283 2:97725444-97725466 GGCCAAGGGACCGAGTCTGGAGG - Intronic
935271845 2:101441438-101441460 GGCAAGGGGGCTGAGTGTGCTGG - Intronic
935609066 2:105001684-105001706 GGCCCAGTGTCAGAGTCAGCAGG - Intergenic
935953131 2:108349212-108349234 GGCCAAGAGCCTGAGGATGCTGG + Intergenic
937895455 2:126974026-126974048 AGCCAAGGGTCTGTGTCCTCAGG - Intergenic
937960453 2:127454054-127454076 GGCCAAAGGTCTTGGTCAGCTGG + Intronic
938473205 2:131585323-131585345 GGCCTGGGGTCTGAGCCTCCTGG - Intergenic
940650578 2:156436415-156436437 GGCCGAGGCTCTGATTCTGGGGG + Intronic
942687281 2:178546626-178546648 AGCAAAGGGTCTGAATCTACAGG - Exonic
943444438 2:187966570-187966592 GGCCAAGGATCTAAGTATGAGGG + Intergenic
944875217 2:203957552-203957574 CGCCCATGGTCTAAGTCTGCTGG + Intronic
945309950 2:208299937-208299959 GGCCAGGGGTTTGAGGCTGTAGG + Intronic
947248945 2:228079642-228079664 GGCCTTGAGCCTGAGTCTGCAGG - Intronic
948336631 2:237213484-237213506 GACCAAGGGTCTGTGTGAGCTGG + Intergenic
1170264306 20:14447720-14447742 GGCCAAAGGTCTGTGACTCCTGG + Intronic
1173170164 20:40717207-40717229 GGCCCATGGACGGAGTCTGCCGG + Intergenic
1173933712 20:46843417-46843439 GGCCCAGGGTCACAGTTTGCAGG + Intergenic
1174403352 20:50288239-50288261 GGAAAAGGGGCTGAGTCTGCAGG + Intergenic
1174408957 20:50321405-50321427 GGCTGGGGGTCTGAGTCAGCTGG - Intergenic
1175116245 20:56684602-56684624 GGCCAGGGGCCTGAGGCTGGAGG + Intergenic
1177801763 21:25834963-25834985 GGCCAAGGTTCTTATTATGCAGG - Intergenic
1178526203 21:33331370-33331392 GGCCAGGGCACTGATTCTGCAGG - Intronic
1179723786 21:43330632-43330654 GCCCAAGTGTCTGAACCTGCAGG - Intergenic
1180248613 21:46564758-46564780 GGACAAGGGTGTGAGCGTGCGGG + Intronic
1180983942 22:19893161-19893183 GGCCAGGGGTCAGTGTCTCCTGG - Intronic
1181029291 22:20142211-20142233 GGCCAAGGGTCTGAGTCTGCAGG + Intronic
1181288526 22:21772568-21772590 GGGCATGGGTCTGAGACTGGAGG - Intronic
1181513946 22:23401107-23401129 TGTCAAGGGTCTGAGTCTGCAGG - Intergenic
1182034287 22:27185705-27185727 GGCCCAGGGTCTGAGGCTGAAGG - Intergenic
1182666771 22:31965812-31965834 TGCCAAAGGACTGAGTCTGAGGG + Intergenic
1183968218 22:41456381-41456403 GGCAAAGGGGCTGAGAGTGCTGG + Intergenic
1184215912 22:43067159-43067181 GCCCAGGGGCCTGGGTCTGCTGG - Intronic
1185166912 22:49266973-49266995 AGCCAAGTGGCTGGGTCTGCCGG + Intergenic
949942421 3:9165105-9165127 GCCCCAGGGCCTGGGTCTGCTGG + Intronic
951656000 3:25009224-25009246 GGCCATGGGTGTGAGTGTGAAGG + Intergenic
954618161 3:51980829-51980851 GGATAAGGGTTGGAGTCTGCAGG - Exonic
955365558 3:58307018-58307040 GGGCAAGGGTGTGAGTCCGGTGG + Intronic
955784966 3:62527712-62527734 GGGCAAGGTTCTGCCTCTGCCGG + Intronic
963946091 3:151146895-151146917 GGCCAGTGGTCTGACTCTGCTGG + Intronic
964343371 3:155731277-155731299 GGCCTTGAGCCTGAGTCTGCAGG - Intronic
965744517 3:171910312-171910334 GGCCAAGAGTTTGAGGCTGCAGG - Intronic
966284588 3:178279002-178279024 GGCCATGGGCCTGAGTCTACAGG - Intergenic
969469243 4:7377379-7377401 TGCCAAGGGTCTGATTCCGGTGG + Intronic
969713489 4:8857673-8857695 CGCCCTGGGTCTGAGTCTGGGGG + Intronic
969746966 4:9080156-9080178 GGCCAAGGCTCTGGGGCTGGAGG - Intergenic
976522036 4:86039679-86039701 GGCTTTGAGTCTGAGTCTGCAGG - Intronic
977754067 4:100644940-100644962 AGCCAAGGCTCAGAGTGTGCTGG - Intronic
979638950 4:122989635-122989657 GGCCTAGAGCCTAAGTCTGCAGG + Intronic
983542802 4:168931045-168931067 GGCCCAGGTTCTGAGCCTCCAGG - Intronic
984891593 4:184498802-184498824 GGCCAAGGGCCTGAGGCAGGTGG + Intergenic
986639477 5:9858089-9858111 GGCCTAGAGTCTGAATCTGTGGG + Intergenic
992766357 5:80004433-80004455 CTGCAAAGGTCTGAGTCTGCGGG - Intronic
994167761 5:96625951-96625973 GGTCAGGGGTCTCAGACTGCAGG - Intronic
995185542 5:109267245-109267267 GGCCAAGAGTCTGGGGCTGTGGG - Intergenic
995268655 5:110195132-110195154 GCCCAAGGCTCTTAATCTGCAGG + Intergenic
996102588 5:119459692-119459714 GGGCAAGAGGCTGAGTGTGCTGG + Intronic
997740805 5:136252051-136252073 GGCCAAGTCTCTGAGTCTCCTGG - Intronic
999159511 5:149483748-149483770 GGCCAGGGGTTAGAGACTGCAGG + Intergenic
999221777 5:149985782-149985804 GGCCCAGGGTCCTAGACTGCTGG - Exonic
1001114830 5:168930824-168930846 GGCCAAGGGACTCAGTGTCCTGG - Intronic
1002462493 5:179381663-179381685 GGCACAGGCTCTGAGACTGCTGG + Intergenic
1002680937 5:180963457-180963479 GGCCTTGAGCCTGAGTCTGCAGG + Intergenic
1002762132 6:210328-210350 GGCCAATGGTCTGAGGGTGTGGG - Intergenic
1003232706 6:4269171-4269193 GGTAAAGGGGCTGAGTGTGCTGG - Intergenic
1006672005 6:35735472-35735494 GGCCAAGGCTCTGAGTGGGCAGG + Intergenic
1006713625 6:36098459-36098481 GGCCAGGAGTTTGAGGCTGCAGG + Intronic
1007292861 6:40800294-40800316 GACCATGGATCTGAGTCTTCAGG + Intergenic
1007633907 6:43286849-43286871 GGCCAGGGGACAGAGGCTGCAGG - Exonic
1011614821 6:89188098-89188120 GCCCAAGAGCCTGAGGCTGCAGG - Intronic
1013032065 6:106343255-106343277 GGCCCAGGGACTGAGCATGCTGG - Intergenic
1013944220 6:115703629-115703651 GGCCTAGTGTCTGAGTCCACTGG + Intergenic
1017135976 6:151147835-151147857 GCCCAGGGCTCTGAGTCTGGGGG - Intergenic
1017414743 6:154207691-154207713 GGCCAAGGGCCACAGTTTGCAGG + Intronic
1017715299 6:157206806-157206828 GGCCCAGGGTTTGCGTCTTCAGG - Exonic
1018300953 6:162402737-162402759 GGCCAAGAGTTTGAGGCTTCAGG - Intronic
1018805019 6:167252324-167252346 GCCCAGGGATCTGAGGCTGCAGG - Intergenic
1018998568 6:168728520-168728542 GGCCAGGAGTTTGAGGCTGCAGG + Intergenic
1019351013 7:553992-554014 CGCCCGGGGTCTGAGTCTGTGGG - Intronic
1021230575 7:18082516-18082538 GGCCCTGTGGCTGAGTCTGCAGG + Intergenic
1023026495 7:36055456-36055478 GGCCAGGGGGCTGGGACTGCAGG - Intergenic
1023840485 7:44094492-44094514 GGCCAGGTGCCTGAGTATGCAGG + Intergenic
1024281308 7:47721905-47721927 GGCCACTGGTCAGAGTCTCCTGG + Intronic
1024349779 7:48352041-48352063 GGCTGGGGCTCTGAGTCTGCAGG + Intronic
1026301522 7:69102131-69102153 GGCCAAGGGGCTGAGCATGGTGG + Intergenic
1026341476 7:69437806-69437828 GGCTAAGGGTGTGAGTCCTCAGG + Intergenic
1029145569 7:98443459-98443481 GCCCCAGGGTCTGTGGCTGCAGG + Intergenic
1029167122 7:98600197-98600219 GGCCAGGAGTCAGAGGCTGCAGG + Intergenic
1029445873 7:100612611-100612633 GGCCCTGGGCCTGGGTCTGCGGG + Exonic
1030475082 7:110021645-110021667 GGCCAAGTATCTGAGCCTGGTGG + Intergenic
1032081268 7:128859675-128859697 GGGGAAGGTGCTGAGTCTGCAGG - Intergenic
1034007619 7:147491283-147491305 GGGCAAGGGTATGAGAGTGCAGG - Intronic
1034992582 7:155557568-155557590 GAGCAAGTGCCTGAGTCTGCTGG - Intergenic
1036698250 8:10993502-10993524 GGCCCAGGGCCTGTGTCTTCAGG + Intronic
1036769939 8:11571948-11571970 GAACAAGGCTCTGAGGCTGCAGG + Intergenic
1037674552 8:21042531-21042553 ACCCCAGGGTCTGAGTCTGGGGG - Intergenic
1038923664 8:32113919-32113941 GGCCAATGGTCTAAGACTTCTGG + Intronic
1039351269 8:36766522-36766544 GGCCAAGGGTGTGAGGCTCTTGG - Intergenic
1039393897 8:37206441-37206463 GGCCAAGGGTCAGGGACTGCAGG + Intergenic
1039863449 8:41479551-41479573 GGGAAAGGGTCTGAGTAGGCGGG - Intergenic
1040033532 8:42846750-42846772 GTCCAGGAGTCTGAGGCTGCTGG + Intergenic
1041550008 8:59089982-59090004 GGCCAACGTTCTGAATCTGATGG - Intronic
1044204328 8:89474599-89474621 GGCCCAGGGTGTCTGTCTGCTGG + Intergenic
1048979127 8:139693772-139693794 GGACCTGGGTCTGATTCTGCAGG + Intronic
1049284601 8:141767680-141767702 GGAGAAGGGGCTGAGGCTGCTGG + Intergenic
1049284614 8:141767741-141767763 GGCGAAGGGGCTGAGGCCGCTGG + Intergenic
1049451685 8:142665357-142665379 GGCCAAGGGCTTGAGCCTGTGGG + Exonic
1049606712 8:143532983-143533005 GGCCAAGGAGCGGAGTCCGCAGG - Intronic
1050048717 9:1575910-1575932 GGCCTTGAGCCTGAGTCTGCAGG + Intergenic
1050503994 9:6328461-6328483 TGCCAAGAGTCTGAGCCTGCAGG + Exonic
1052233935 9:26188277-26188299 GGCCTGGAGTCTGAGTCTGTTGG - Intergenic
1052735626 9:32339337-32339359 GGCCAAAGGCCTGAGTACGCAGG - Intergenic
1053523394 9:38804777-38804799 GGCCTAGAGCCTGAGTCTGTGGG + Intergenic
1054195623 9:62029196-62029218 GGCCTAGAGCCTGAGTCTGTGGG + Intergenic
1054642784 9:67559493-67559515 GGCCTAGAGCCTGAGTCTGTGGG - Intergenic
1058013409 9:100003719-100003741 GGCCTTGAGCCTGAGTCTGCAGG + Intronic
1058013546 9:100004389-100004411 GGTCCAGAGACTGAGTCTGCTGG + Intronic
1058800908 9:108543624-108543646 GGACAAAGGTCTGAGTAAGCTGG + Intergenic
1062472868 9:136713886-136713908 GGCCCACGGTCTGAGCCTGCTGG + Intronic
1186787672 X:12968736-12968758 GACCAAGGTTCTCAGACTGCTGG - Intergenic
1188058703 X:25573688-25573710 GGCCCAGAGCCTGACTCTGCAGG + Intergenic
1190968271 X:55323450-55323472 GGCCTGGAGTCTGTGTCTGCAGG + Intergenic
1191062870 X:56318180-56318202 GGCCAGGAGCCTGAGTCTGTGGG - Intergenic
1191112941 X:56821915-56821937 GGCCTAGAGCCTGGGTCTGCAGG - Intergenic
1192793961 X:74411485-74411507 GGGCCAGGGTCTGAGAATGCAGG + Intergenic
1195135767 X:101906396-101906418 GGCCTGGAGGCTGAGTCTGCAGG - Intronic
1195816520 X:108894575-108894597 AGCCATGAGCCTGAGTCTGCAGG - Intergenic
1196588494 X:117458513-117458535 GGCCTAGAGTCTGAGTCTATAGG - Intergenic
1197846735 X:130811082-130811104 GGCCTAGAGCCTGAGTCTGCAGG - Intronic
1198806854 X:140502209-140502231 GGCCAAGGGTCAGGGACTGGAGG + Intergenic
1198940696 X:141952557-141952579 AGCCTAGAGTATGAGTCTGCAGG + Intergenic
1199445048 X:147911827-147911849 GGCCGAGGGGCTGAGCCCGCGGG + Intergenic