ID: 1181030402

View in Genome Browser
Species Human (GRCh38)
Location 22:20146737-20146759
Sequence GGTTCCTGAGAGTCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 157}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181030402_1181030414 13 Left 1181030402 22:20146737-20146759 CCCACAGGGGACTCTCAGGAACC 0: 1
1: 0
2: 1
3: 25
4: 157
Right 1181030414 22:20146773-20146795 AGATGAAATGGGGGTGCATAGGG 0: 1
1: 1
2: 0
3: 7
4: 181
1181030402_1181030412 4 Left 1181030402 22:20146737-20146759 CCCACAGGGGACTCTCAGGAACC 0: 1
1: 0
2: 1
3: 25
4: 157
Right 1181030412 22:20146764-20146786 AGCTTGGGGAGATGAAATGGGGG 0: 1
1: 1
2: 4
3: 25
4: 298
1181030402_1181030413 12 Left 1181030402 22:20146737-20146759 CCCACAGGGGACTCTCAGGAACC 0: 1
1: 0
2: 1
3: 25
4: 157
Right 1181030413 22:20146772-20146794 GAGATGAAATGGGGGTGCATAGG 0: 1
1: 1
2: 0
3: 19
4: 199
1181030402_1181030406 -10 Left 1181030402 22:20146737-20146759 CCCACAGGGGACTCTCAGGAACC 0: 1
1: 0
2: 1
3: 25
4: 157
Right 1181030406 22:20146750-20146772 CTCAGGAACCCGAGAGCTTGGGG 0: 1
1: 0
2: 2
3: 19
4: 284
1181030402_1181030410 2 Left 1181030402 22:20146737-20146759 CCCACAGGGGACTCTCAGGAACC 0: 1
1: 0
2: 1
3: 25
4: 157
Right 1181030410 22:20146762-20146784 AGAGCTTGGGGAGATGAAATGGG 0: 2
1: 0
2: 1
3: 26
4: 353
1181030402_1181030409 1 Left 1181030402 22:20146737-20146759 CCCACAGGGGACTCTCAGGAACC 0: 1
1: 0
2: 1
3: 25
4: 157
Right 1181030409 22:20146761-20146783 GAGAGCTTGGGGAGATGAAATGG 0: 1
1: 0
2: 3
3: 47
4: 360
1181030402_1181030416 25 Left 1181030402 22:20146737-20146759 CCCACAGGGGACTCTCAGGAACC 0: 1
1: 0
2: 1
3: 25
4: 157
Right 1181030416 22:20146785-20146807 GGTGCATAGGGGCCACCTGTTGG 0: 1
1: 1
2: 0
3: 11
4: 98
1181030402_1181030415 14 Left 1181030402 22:20146737-20146759 CCCACAGGGGACTCTCAGGAACC 0: 1
1: 0
2: 1
3: 25
4: 157
Right 1181030415 22:20146774-20146796 GATGAAATGGGGGTGCATAGGGG 0: 1
1: 1
2: 2
3: 21
4: 210
1181030402_1181030411 3 Left 1181030402 22:20146737-20146759 CCCACAGGGGACTCTCAGGAACC 0: 1
1: 0
2: 1
3: 25
4: 157
Right 1181030411 22:20146763-20146785 GAGCTTGGGGAGATGAAATGGGG 0: 1
1: 1
2: 0
3: 41
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181030402 Original CRISPR GGTTCCTGAGAGTCCCCTGT GGG (reversed) Intronic
900247417 1:1643505-1643527 GGTTCCTGAAAATCACCTGACGG + Intronic
900258641 1:1710637-1710659 GGTTCCTGAAAATCACCTGACGG + Intronic
901680800 1:10911655-10911677 GGGCCCTGAGACTGCCCTGTGGG - Intergenic
902246586 1:15124729-15124751 GGATCCTGAGACTTCCCTGAAGG - Intergenic
904377421 1:30090533-30090555 GCTTCCAGAGAGGCCCCTGGGGG + Intergenic
905250897 1:36647695-36647717 GGTTGCTGTGAGACCCCAGTAGG + Intergenic
906802478 1:48749971-48749993 GTTTCCTGAGGGACCACTGTGGG + Intronic
912074095 1:105850582-105850604 GGTTCCATAAAGTCCCCAGTGGG + Intergenic
913448093 1:118971336-118971358 GGTGCCTGCCAGTCACCTGTAGG - Intronic
922249291 1:223832929-223832951 GGTTCCACAGAGACCCCTGTGGG - Intronic
922868690 1:228882721-228882743 TGTTACTGAGGGTCCCCAGTGGG - Intergenic
923264826 1:232304335-232304357 TGTTCTTTAGAGTCCCCTGGGGG + Intergenic
923474384 1:234318986-234319008 GTTTCCTGAGGGTCCTCTGTGGG - Intronic
1063176073 10:3552115-3552137 GTTTCCTGGGAGTCCCCACTGGG - Intergenic
1063446809 10:6123607-6123629 GGTTCGTGACAAACCCCTGTGGG + Intergenic
1067223839 10:44362937-44362959 GGTACCTGAAAGTCCTGTGTGGG + Intergenic
1070755792 10:78992547-78992569 ACTTCCTGCGAGTCCCCTGAGGG - Intergenic
1072631720 10:97151200-97151222 AGTTCCTGAGGGCCTCCTGTGGG - Intronic
1073189772 10:101643071-101643093 GGCTCATGAGAGTCTCCTGTTGG - Intronic
1076889387 10:133276438-133276460 GGTTCCTGGGATTCACCTGTGGG - Intronic
1077375044 11:2201834-2201856 GGGTCCTGAGATTCCCCTACAGG - Intergenic
1078070560 11:8106541-8106563 GGTTCCTCAGTATCCCCTGTGGG + Intronic
1078182262 11:9021940-9021962 AGTTCCTGGTAGTCCTCTGTTGG + Exonic
1083572204 11:63766815-63766837 GCTTCCTGAGACTCCCATTTTGG + Intronic
1084326921 11:68405867-68405889 GGCTCCTGAGAGTCCCAGCTAGG - Intronic
1084472392 11:69370685-69370707 GGCTCCTGACAGTTTCCTGTGGG + Intergenic
1084649364 11:70479610-70479632 AGTTCCCCAGAGTCCCCTCTAGG - Intronic
1085771209 11:79327774-79327796 GGTACCTCAGAGTCCTCTGTGGG + Intronic
1085816775 11:79745741-79745763 GGTTCAAGAGAGTCAGCTGTAGG + Intergenic
1089892826 11:121898530-121898552 GGTTGCTGACCTTCCCCTGTGGG + Intergenic
1094863812 12:34503911-34503933 GGTTTCTGAGAATCCGCTTTGGG - Intergenic
1096121104 12:49089993-49090015 GGTTCTGGAGAGTCACCAGTGGG - Exonic
1096429369 12:51530665-51530687 GGTTCCTGAAAGTTCTCTGGAGG + Intergenic
1097187945 12:57205519-57205541 GGGTCATGAGAGTCCACAGTTGG - Intronic
1103736531 12:123064378-123064400 GGTGGCTGAGAGCCTCCTGTGGG - Intronic
1107781874 13:43912269-43912291 GGTTCCTGTGGGTCGCCTGTGGG + Intergenic
1114269599 14:21092636-21092658 GGCTCCCGAGCGTCCCCTGGCGG - Exonic
1118419084 14:65579720-65579742 GGTCCTTTAGAGTCCCCAGTGGG + Intronic
1118728530 14:68649984-68650006 GGCTCCTGAGAGCCACCTCTTGG + Intronic
1119472641 14:74909366-74909388 GGCTCCTGGGAGTACCCTGTGGG - Intronic
1119615466 14:76096060-76096082 GGTTCATGAAAATCACCTGTGGG - Intergenic
1121388362 14:93551544-93551566 GGTTCCTGAGTCTCCCATCTCGG - Intronic
1121949405 14:98157174-98157196 GTTTCCTGAGTGCCCCTTGTGGG - Intergenic
1123129741 14:105975168-105975190 AGGTCCTGAGCGACCCCTGTAGG - Intergenic
1123132392 14:105999418-105999440 GGTTCCTGAGTGCCCCCTGGTGG + Intergenic
1123132542 14:105999987-106000009 GTTTCCTGAGCATCCCCTGGTGG + Intergenic
1123137746 14:106045260-106045282 GGTTTCTGAGAATCTCTTGTTGG + Intergenic
1123164057 14:106309001-106309023 TGGTCCTGAGCGCCCCCTGTTGG + Intergenic
1123218152 14:106831426-106831448 GGTTCCTGAGTGCCCCCTGGTGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1123578068 15:21692962-21692984 GGGTCCTGAGCGTCCCCAGGTGG + Intergenic
1123582638 15:21730650-21730672 GGTTCCTGAGCGCCCCCTGGTGG + Intergenic
1123582803 15:21731318-21731340 GGTTCCTTAGGGCCCCCTGGTGG + Intergenic
1123614693 15:22135444-22135466 GGGTCCTGAGTGTCCCCAGGTGG + Intergenic
1123619288 15:22173246-22173268 GGTTCCTGAGCGCCCCCTGGTGG + Intergenic
1123619453 15:22173914-22173936 GGTTCCTTAGGGCCCCCTGGTGG + Intergenic
1123936374 15:25196086-25196108 GGTCCCTGAGCGTCACCTTTCGG + Intergenic
1124905820 15:33867656-33867678 GGTTTCTGAGAATCCCTTGAAGG + Exonic
1125317097 15:38442630-38442652 GGTTCCTGCCAGTCCTGTGTGGG + Intergenic
1125513232 15:40303857-40303879 GGCTCCAGAGGCTCCCCTGTAGG - Intronic
1127643264 15:60935065-60935087 ATTTCCTGAGGGCCCCCTGTGGG - Intronic
1129717277 15:77859752-77859774 TGGGTCTGAGAGTCCCCTGTAGG + Intergenic
1129785653 15:78308513-78308535 GGTCCTTGACAGTCCCCAGTCGG + Intergenic
1130461759 15:84164547-84164569 TGGGTCTGAGAGTCCCCTGTAGG - Intergenic
1132149657 15:99450643-99450665 GGTGCCTCAGGGTCCCCTGGAGG + Intergenic
1202986938 15_KI270727v1_random:427207-427229 GGGTCCTGAGCGTCCCCAGGTGG + Intergenic
1132550086 16:550700-550722 GGTCGGTGAGGGTCCCCTGTCGG + Intronic
1132550148 16:550863-550885 GGTCGGTGAGGGTCCCCTGTCGG + Intronic
1132550182 16:550962-550984 GGTCGGTGAGGGTCCCCTGTTGG + Intronic
1132550194 16:550995-551017 GGTCGGTGAGGGTCCCCTGTCGG + Intronic
1132550291 16:551241-551263 GGTCGGTGAGGGTCCCCTGTCGG + Intronic
1132689622 16:1176714-1176736 GCTTCATGAGCATCCCCTGTGGG - Intronic
1133050607 16:3115412-3115434 GACTCCTGAGTGTCCCCTGAAGG - Exonic
1136872135 16:33816869-33816891 GTGTCCTGAGCGTCCCCTGGTGG - Intergenic
1138169639 16:54836648-54836670 AGATGCTGAGAGTCCCTTGTTGG - Intergenic
1138390338 16:56665996-56666018 GAATCCTGAGAGCTCCCTGTTGG - Intronic
1139163596 16:64539892-64539914 GTTTCCAGAGAGACACCTGTGGG + Intergenic
1140254991 16:73327840-73327862 AGGTCCTCAGAGTCCCCTGGGGG - Intergenic
1140702723 16:77597396-77597418 GGACACTGGGAGTCCCCTGTTGG + Intergenic
1141271391 16:82544242-82544264 GGATCCTGTGTGTCCCCTTTGGG - Intergenic
1141697796 16:85628342-85628364 GGTCCCTGGGGGTCCCCTGCGGG - Intronic
1203100037 16_KI270728v1_random:1299199-1299221 GTGTCCTGAGCGTCCCCTGGTGG + Intergenic
1142851401 17:2706522-2706544 GGTTCCTGGGAGTCCACTGCAGG - Intronic
1143037002 17:4005150-4005172 GTTTCCTGTGAGTCCCCTCTTGG + Exonic
1144753803 17:17667751-17667773 GGCCCCTGAGAGTCATCTGTGGG - Intergenic
1146407723 17:32553736-32553758 TGTTCCTGAGAGTTCCTTATTGG + Intronic
1147321963 17:39652009-39652031 GGTTCCTGAGAGCCCGATGCTGG + Intronic
1148238143 17:45983066-45983088 GGCTCCTGAGGGCCTCCTGTTGG - Intronic
1151379763 17:73717586-73717608 GGATACTGAATGTCCCCTGTGGG - Intergenic
1151745711 17:76010629-76010651 GTTTCCTGAGACTCCCCAGTGGG + Intronic
1152201923 17:78952358-78952380 GCTTCCTGGGAGTCCCCTCCAGG + Intergenic
1152325276 17:79632406-79632428 GTTTCCAGAGGGACCCCTGTTGG + Intergenic
1153429082 18:4995666-4995688 AGTTCCTGTGAGTCTCATGTTGG - Intergenic
1153952687 18:10070417-10070439 TCTTCCTGAGACTCCCCTGCTGG + Intergenic
1158188476 18:54798269-54798291 GATTCCTCAGGGTCTCCTGTTGG - Intronic
1161356664 19:3822976-3822998 GGCTCCGCAGGGTCCCCTGTTGG + Intronic
925146673 2:1587206-1587228 GGTTCCAGGGAGGGCCCTGTGGG - Intergenic
927150509 2:20192773-20192795 GCTGCCTCAGAGCCCCCTGTGGG - Intergenic
929536445 2:42787207-42787229 GGTGCCTGAGTGTCCCCTGAGGG - Intronic
929598811 2:43192342-43192364 CAGTCCTCAGAGTCCCCTGTAGG + Intergenic
932732871 2:74232939-74232961 GGTTCCTGAGGGGCCCCAGCTGG + Intronic
935214996 2:100968923-100968945 GGTTCCTGGGAGGTCCCTGCTGG + Intronic
935597415 2:104890076-104890098 GGGACCTGAGAGTCCCGTGACGG - Intergenic
936494885 2:113009820-113009842 GGTTTCTGAGAGTCTACTGTGGG + Intergenic
936680570 2:114766190-114766212 GGTTTCTGAGAGTTCCATTTAGG - Intronic
938449161 2:131401030-131401052 GGCTCCTGAGTGTCCCCTCCTGG - Intergenic
941708895 2:168690697-168690719 GGTTTCTGTGAGACCCCTGCAGG + Intronic
942158467 2:173156730-173156752 GGTTCCTAACAGACCACTGTTGG + Intronic
942664752 2:178305471-178305493 GGTTGTTGAGAGTCACATGTAGG + Intronic
943007221 2:182400562-182400584 TGCTCCTGAGAGTCCTCTGGAGG - Intronic
944973077 2:205016445-205016467 AGTTCCTGAGTGTCTCCTCTGGG - Intronic
948630613 2:239300293-239300315 CCTTCCTGAGAGTGCGCTGTAGG + Intronic
948717153 2:239872226-239872248 GCGTCCTGAGAGTCCCCGGGGGG + Intergenic
1169869994 20:10239887-10239909 GGTTCCAGAAAGGCCCCTGTAGG - Intronic
1170892779 20:20390290-20390312 GGTTCCTAAGAGCCACATGTTGG - Intronic
1172122184 20:32604938-32604960 GGCTCCTGAAGGTCCCCTGAAGG + Intronic
1172189041 20:33050470-33050492 GGTGTGTCAGAGTCCCCTGTTGG + Intergenic
1172882165 20:38209083-38209105 AGAGCCAGAGAGTCCCCTGTAGG - Intergenic
1175196824 20:57249833-57249855 GTTTACTGAGAGTTCCCTGCAGG + Intronic
1175410393 20:58763840-58763862 GGTCCCTGAGTTTCCCCTGGAGG + Intergenic
1176090988 20:63318588-63318610 TGATCCTGAGACTCCCCTGTGGG + Intronic
1176204237 20:63879419-63879441 GGGTCCTGAGCGTGACCTGTGGG - Intronic
1176204251 20:63879484-63879506 GGGTCCTGAGCGTGACCTGTGGG - Intronic
1179880257 21:44290660-44290682 GGTACCTGGGAGACCCCTGAAGG + Intronic
1180011691 21:45055375-45055397 AGTTCCTGAGAGTTCCGGGTGGG - Intergenic
1181030402 22:20146737-20146759 GGTTCCTGAGAGTCCCCTGTGGG - Intronic
1181512891 22:23396642-23396664 GGTTCCTGGGATTCCCCTGTGGG + Intergenic
1181529912 22:23511555-23511577 GGTGCCTGAAGGTCCCCTCTTGG + Intergenic
1182082591 22:27539743-27539765 GGGTGCTGAGAGTCCCTTGGGGG + Intergenic
1182349295 22:29690009-29690031 CGTTCCTGAGTGCCCCCTGCTGG - Intronic
1183354126 22:37349439-37349461 GGTTCCTGAGAGGCCCCCCAGGG + Intergenic
1184179983 22:42814619-42814641 GGTCACTGACAGGCCCCTGTGGG - Intronic
1184691157 22:46117936-46117958 GCTTCCTGACAGTCCCCAGAGGG + Intergenic
952751941 3:36831743-36831765 GGTTCCCGAGAGGCTCCTGAAGG - Exonic
953414033 3:42705404-42705426 GGTGCCCCAGAGGCCCCTGTGGG + Intronic
955353170 3:58209161-58209183 GGTGACTGTGAGTGCCCTGTAGG + Intronic
956716842 3:72086934-72086956 GGGTCCTGGGAGTCCCCGGCGGG + Intergenic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
961869439 3:129977059-129977081 GGGCCCTGGGAGGCCCCTGTGGG + Exonic
962669083 3:137686607-137686629 GGTTCCTGAAGCTTCCCTGTGGG + Intergenic
962707627 3:138060970-138060992 AGTTTCTCAGAGTCCCTTGTGGG - Intergenic
964449687 3:156800143-156800165 GGATCCTGTGAGGCCACTGTGGG + Intergenic
968855300 4:3115752-3115774 GGTTCCTGCGGGTTCTCTGTAGG + Intronic
969619400 4:8271455-8271477 GGTTCCTGGGAGCCCCGTGTGGG + Intronic
974335623 4:60540843-60540865 GGTTCCAGAGAGTTGACTGTGGG + Intergenic
974671126 4:65031633-65031655 GGTTCCTCAGAGTTCCATCTTGG - Intergenic
981077688 4:140607403-140607425 GGTGCCTAGGAGTTCCCTGTTGG - Intergenic
985831708 5:2238787-2238809 GGGTCCTGAGAGTGCGCTGGAGG - Intergenic
986400372 5:7373137-7373159 GGTTCCTGATAGGCCCCTCAAGG + Intergenic
988911923 5:35852024-35852046 GGTTCCTGAGGGACCACAGTTGG - Intergenic
996035989 5:118759410-118759432 GGTGACTGAAATTCCCCTGTTGG + Intergenic
996915106 5:128703107-128703129 GTTTCCAGAGAGGCTCCTGTGGG + Intronic
1001933423 5:175688566-175688588 TGTTTCTGGGAGTCCCCTGCTGG - Intergenic
1002343642 5:178533090-178533112 TTTTCCTTAGAATCCCCTGTAGG - Intronic
1003370433 6:5520236-5520258 GGTTCCTGAGGCCCCCATGTGGG + Intronic
1007566984 6:42859027-42859049 GGTTTCTGTGAGTCCACTGTGGG + Intronic
1008806173 6:55431401-55431423 GGTTCCTCAGAATCCCCTGGAGG + Intergenic
1009808845 6:68635669-68635691 GGTTCCTTAGAGTCTCCCTTGGG + Exonic
1012996573 6:105981445-105981467 GGTACCCGAGAGTACCCTCTGGG + Intergenic
1016873392 6:148840576-148840598 GGTCCCTCAGAGTCCACTGTGGG - Intronic
1019079534 6:169420851-169420873 CGTTTATGAGAGTCCCCGGTGGG - Intergenic
1019306912 7:339943-339965 GCTTCCTCCGAGGCCCCTGTGGG - Intergenic
1021453491 7:20803778-20803800 GGGTCCTCAGAGTCCTCTTTTGG - Intergenic
1023932270 7:44713169-44713191 GGATCCTGTCTGTCCCCTGTAGG + Intergenic
1029638055 7:101798643-101798665 GTTTCCTGCTAGTCCCCTGACGG - Intergenic
1032364635 7:131287622-131287644 GGTTCCAGAGATTCGGCTGTGGG + Intronic
1041582004 8:59471689-59471711 GTTTCCTGAGAGGCCCAAGTTGG - Intergenic
1041798041 8:61767655-61767677 TTTTCCTGAGAGTCACCTGGTGG + Intergenic
1045010990 8:97958251-97958273 GGTTCCTGCCAGACCCCTGATGG + Intronic
1045199353 8:99963831-99963853 TGTTCCTCAGTGTCCACTGTGGG - Intronic
1052799616 9:32955875-32955897 GGTGCCTGGAAGTCCCCTGCGGG + Intergenic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1056763857 9:89432848-89432870 TGTTCCTGAGATTCCACTCTGGG + Intronic
1057423555 9:94930577-94930599 GTTTCCCCAGAGTCCTCTGTTGG - Intronic
1061280087 9:129592994-129593016 GGTTGAAGAGAGTCCCCTGTGGG + Intergenic
1061425760 9:130497575-130497597 AGTTCCTGAGAAACCCCTCTTGG + Intronic
1061488865 9:130934268-130934290 GGTCCCAGAGACTCCCCTGGGGG + Intronic
1189973209 X:46438551-46438573 GTTTCCAGAGAGTTCCCTGCAGG - Intergenic
1192184070 X:68934665-68934687 GGGTCCTGAAAGACCTCTGTGGG - Intergenic
1196793317 X:119483215-119483237 GGATCCTGAGAGTCTCCTTTGGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1202080371 Y:21077961-21077983 GGTTCCTGACTGTCCTCAGTGGG + Intergenic
1202377509 Y:24250603-24250625 TGGGTCTGAGAGTCCCCTGTAGG + Intergenic
1202493272 Y:25419519-25419541 TGGGTCTGAGAGTCCCCTGTAGG - Intergenic