ID: 1181035728

View in Genome Browser
Species Human (GRCh38)
Location 22:20168940-20168962
Sequence AGTGATCTGCGGACTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181035713_1181035728 20 Left 1181035713 22:20168897-20168919 CCTGGGGAGCGGCTGTTCCCAGA No data
Right 1181035728 22:20168940-20168962 AGTGATCTGCGGACTGGGGAGGG No data
1181035716_1181035728 -3 Left 1181035716 22:20168920-20168942 CCCTACATGCCTCCCCCACGAGT No data
Right 1181035728 22:20168940-20168962 AGTGATCTGCGGACTGGGGAGGG No data
1181035717_1181035728 -4 Left 1181035717 22:20168921-20168943 CCTACATGCCTCCCCCACGAGTG No data
Right 1181035728 22:20168940-20168962 AGTGATCTGCGGACTGGGGAGGG No data
1181035714_1181035728 3 Left 1181035714 22:20168914-20168936 CCCAGACCCTACATGCCTCCCCC No data
Right 1181035728 22:20168940-20168962 AGTGATCTGCGGACTGGGGAGGG No data
1181035715_1181035728 2 Left 1181035715 22:20168915-20168937 CCAGACCCTACATGCCTCCCCCA No data
Right 1181035728 22:20168940-20168962 AGTGATCTGCGGACTGGGGAGGG No data
1181035712_1181035728 21 Left 1181035712 22:20168896-20168918 CCCTGGGGAGCGGCTGTTCCCAG No data
Right 1181035728 22:20168940-20168962 AGTGATCTGCGGACTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181035728 Original CRISPR AGTGATCTGCGGACTGGGGA GGG Intergenic
No off target data available for this crispr