ID: 1181036155

View in Genome Browser
Species Human (GRCh38)
Location 22:20170648-20170670
Sequence GCTTCTCTGCTGAGGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181036155_1181036166 29 Left 1181036155 22:20170648-20170670 CCATCCAGCCTCAGCAGAGAAGC No data
Right 1181036166 22:20170700-20170722 CGGAAGGAGGTGATGCTGTTCGG No data
1181036155_1181036162 6 Left 1181036155 22:20170648-20170670 CCATCCAGCCTCAGCAGAGAAGC No data
Right 1181036162 22:20170677-20170699 GGAGAGCAGGTAGAACATCAAGG No data
1181036155_1181036167 30 Left 1181036155 22:20170648-20170670 CCATCCAGCCTCAGCAGAGAAGC No data
Right 1181036167 22:20170701-20170723 GGAAGGAGGTGATGCTGTTCGGG No data
1181036155_1181036163 9 Left 1181036155 22:20170648-20170670 CCATCCAGCCTCAGCAGAGAAGC No data
Right 1181036163 22:20170680-20170702 GAGCAGGTAGAACATCAAGGCGG No data
1181036155_1181036165 16 Left 1181036155 22:20170648-20170670 CCATCCAGCCTCAGCAGAGAAGC No data
Right 1181036165 22:20170687-20170709 TAGAACATCAAGGCGGAAGGAGG No data
1181036155_1181036161 -7 Left 1181036155 22:20170648-20170670 CCATCCAGCCTCAGCAGAGAAGC No data
Right 1181036161 22:20170664-20170686 GAGAAGCAAGGGCGGAGAGCAGG No data
1181036155_1181036164 13 Left 1181036155 22:20170648-20170670 CCATCCAGCCTCAGCAGAGAAGC No data
Right 1181036164 22:20170684-20170706 AGGTAGAACATCAAGGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181036155 Original CRISPR GCTTCTCTGCTGAGGCTGGA TGG (reversed) Intergenic
No off target data available for this crispr