ID: 1181036161

View in Genome Browser
Species Human (GRCh38)
Location 22:20170664-20170686
Sequence GAGAAGCAAGGGCGGAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181036154_1181036161 3 Left 1181036154 22:20170638-20170660 CCAGACTTCTCCATCCAGCCTCA No data
Right 1181036161 22:20170664-20170686 GAGAAGCAAGGGCGGAGAGCAGG No data
1181036153_1181036161 25 Left 1181036153 22:20170616-20170638 CCTCTGTAGAGGGCAGCTGAGGC No data
Right 1181036161 22:20170664-20170686 GAGAAGCAAGGGCGGAGAGCAGG No data
1181036155_1181036161 -7 Left 1181036155 22:20170648-20170670 CCATCCAGCCTCAGCAGAGAAGC No data
Right 1181036161 22:20170664-20170686 GAGAAGCAAGGGCGGAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181036161 Original CRISPR GAGAAGCAAGGGCGGAGAGC AGG Intergenic
No off target data available for this crispr