ID: 1181036167

View in Genome Browser
Species Human (GRCh38)
Location 22:20170701-20170723
Sequence GGAAGGAGGTGATGCTGTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181036159_1181036167 22 Left 1181036159 22:20170656-20170678 CCTCAGCAGAGAAGCAAGGGCGG No data
Right 1181036167 22:20170701-20170723 GGAAGGAGGTGATGCTGTTCGGG No data
1181036155_1181036167 30 Left 1181036155 22:20170648-20170670 CCATCCAGCCTCAGCAGAGAAGC No data
Right 1181036167 22:20170701-20170723 GGAAGGAGGTGATGCTGTTCGGG No data
1181036156_1181036167 26 Left 1181036156 22:20170652-20170674 CCAGCCTCAGCAGAGAAGCAAGG No data
Right 1181036167 22:20170701-20170723 GGAAGGAGGTGATGCTGTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181036167 Original CRISPR GGAAGGAGGTGATGCTGTTC GGG Intergenic
No off target data available for this crispr