ID: 1181037558

View in Genome Browser
Species Human (GRCh38)
Location 22:20177248-20177270
Sequence AATCTAGGGGGAACCTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181037558_1181037563 -4 Left 1181037558 22:20177248-20177270 CCATGTCAGGTTCCCCCTAGATT No data
Right 1181037563 22:20177267-20177289 GATTCCCCCTCCGCACCCTTTGG No data
1181037558_1181037572 23 Left 1181037558 22:20177248-20177270 CCATGTCAGGTTCCCCCTAGATT No data
Right 1181037572 22:20177294-20177316 AGTCCTCCTGCTCGGACCATAGG No data
1181037558_1181037571 15 Left 1181037558 22:20177248-20177270 CCATGTCAGGTTCCCCCTAGATT No data
Right 1181037571 22:20177286-20177308 TTGGCTGAAGTCCTCCTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181037558 Original CRISPR AATCTAGGGGGAACCTGACA TGG (reversed) Intergenic
No off target data available for this crispr