ID: 1181038068

View in Genome Browser
Species Human (GRCh38)
Location 22:20179376-20179398
Sequence TCCAGGTGGGCCTCAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181038068_1181038086 26 Left 1181038068 22:20179376-20179398 CCTGGGCTTGAGGCCCACCTGGA No data
Right 1181038086 22:20179425-20179447 GTGGGGCAGGGGAGGGGAGGTGG No data
1181038068_1181038078 9 Left 1181038068 22:20179376-20179398 CCTGGGCTTGAGGCCCACCTGGA No data
Right 1181038078 22:20179408-20179430 ACGTAGATGTGGGTAGGGTGGGG No data
1181038068_1181038077 8 Left 1181038068 22:20179376-20179398 CCTGGGCTTGAGGCCCACCTGGA No data
Right 1181038077 22:20179407-20179429 AACGTAGATGTGGGTAGGGTGGG No data
1181038068_1181038081 15 Left 1181038068 22:20179376-20179398 CCTGGGCTTGAGGCCCACCTGGA No data
Right 1181038081 22:20179414-20179436 ATGTGGGTAGGGTGGGGCAGGGG No data
1181038068_1181038083 19 Left 1181038068 22:20179376-20179398 CCTGGGCTTGAGGCCCACCTGGA No data
Right 1181038083 22:20179418-20179440 GGGTAGGGTGGGGCAGGGGAGGG No data
1181038068_1181038076 7 Left 1181038068 22:20179376-20179398 CCTGGGCTTGAGGCCCACCTGGA No data
Right 1181038076 22:20179406-20179428 AAACGTAGATGTGGGTAGGGTGG No data
1181038068_1181038079 13 Left 1181038068 22:20179376-20179398 CCTGGGCTTGAGGCCCACCTGGA No data
Right 1181038079 22:20179412-20179434 AGATGTGGGTAGGGTGGGGCAGG No data
1181038068_1181038082 18 Left 1181038068 22:20179376-20179398 CCTGGGCTTGAGGCCCACCTGGA No data
Right 1181038082 22:20179417-20179439 TGGGTAGGGTGGGGCAGGGGAGG No data
1181038068_1181038087 27 Left 1181038068 22:20179376-20179398 CCTGGGCTTGAGGCCCACCTGGA No data
Right 1181038087 22:20179426-20179448 TGGGGCAGGGGAGGGGAGGTGGG No data
1181038068_1181038085 23 Left 1181038068 22:20179376-20179398 CCTGGGCTTGAGGCCCACCTGGA No data
Right 1181038085 22:20179422-20179444 AGGGTGGGGCAGGGGAGGGGAGG No data
1181038068_1181038075 4 Left 1181038068 22:20179376-20179398 CCTGGGCTTGAGGCCCACCTGGA No data
Right 1181038075 22:20179403-20179425 TGCAAACGTAGATGTGGGTAGGG No data
1181038068_1181038084 20 Left 1181038068 22:20179376-20179398 CCTGGGCTTGAGGCCCACCTGGA No data
Right 1181038084 22:20179419-20179441 GGTAGGGTGGGGCAGGGGAGGGG No data
1181038068_1181038074 3 Left 1181038068 22:20179376-20179398 CCTGGGCTTGAGGCCCACCTGGA No data
Right 1181038074 22:20179402-20179424 GTGCAAACGTAGATGTGGGTAGG No data
1181038068_1181038080 14 Left 1181038068 22:20179376-20179398 CCTGGGCTTGAGGCCCACCTGGA No data
Right 1181038080 22:20179413-20179435 GATGTGGGTAGGGTGGGGCAGGG No data
1181038068_1181038072 -2 Left 1181038068 22:20179376-20179398 CCTGGGCTTGAGGCCCACCTGGA No data
Right 1181038072 22:20179397-20179419 GATCTGTGCAAACGTAGATGTGG No data
1181038068_1181038073 -1 Left 1181038068 22:20179376-20179398 CCTGGGCTTGAGGCCCACCTGGA No data
Right 1181038073 22:20179398-20179420 ATCTGTGCAAACGTAGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181038068 Original CRISPR TCCAGGTGGGCCTCAAGCCC AGG (reversed) Intergenic
No off target data available for this crispr