ID: 1181039140

View in Genome Browser
Species Human (GRCh38)
Location 22:20183779-20183801
Sequence TGTGCCCAGGTGCCCCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181039140_1181039149 24 Left 1181039140 22:20183779-20183801 CCTGCCTGGGGCACCTGGGCACA No data
Right 1181039149 22:20183826-20183848 AACACATGCCCCCATCCTTCGGG No data
1181039140_1181039144 -9 Left 1181039140 22:20183779-20183801 CCTGCCTGGGGCACCTGGGCACA No data
Right 1181039144 22:20183793-20183815 CTGGGCACAGTGGAGAAAGATGG No data
1181039140_1181039150 25 Left 1181039140 22:20183779-20183801 CCTGCCTGGGGCACCTGGGCACA No data
Right 1181039150 22:20183827-20183849 ACACATGCCCCCATCCTTCGGGG No data
1181039140_1181039145 -2 Left 1181039140 22:20183779-20183801 CCTGCCTGGGGCACCTGGGCACA No data
Right 1181039145 22:20183800-20183822 CAGTGGAGAAAGATGGCTCCCGG No data
1181039140_1181039148 23 Left 1181039140 22:20183779-20183801 CCTGCCTGGGGCACCTGGGCACA No data
Right 1181039148 22:20183825-20183847 GAACACATGCCCCCATCCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181039140 Original CRISPR TGTGCCCAGGTGCCCCAGGC AGG (reversed) Intergenic
No off target data available for this crispr