ID: 1181039760

View in Genome Browser
Species Human (GRCh38)
Location 22:20186450-20186472
Sequence CTGCACAGGAGCGTGAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181039760_1181039766 -9 Left 1181039760 22:20186450-20186472 CCTCTGCTCACGCTCCTGTGCAG No data
Right 1181039766 22:20186464-20186486 CCTGTGCAGGGAGGGACTTGAGG No data
1181039760_1181039772 3 Left 1181039760 22:20186450-20186472 CCTCTGCTCACGCTCCTGTGCAG No data
Right 1181039772 22:20186476-20186498 GGGACTTGAGGGTGGGCCTGGGG No data
1181039760_1181039771 2 Left 1181039760 22:20186450-20186472 CCTCTGCTCACGCTCCTGTGCAG No data
Right 1181039771 22:20186475-20186497 AGGGACTTGAGGGTGGGCCTGGG No data
1181039760_1181039775 20 Left 1181039760 22:20186450-20186472 CCTCTGCTCACGCTCCTGTGCAG No data
Right 1181039775 22:20186493-20186515 CTGGGGAAACTGTGGAAAGTAGG No data
1181039760_1181039769 -4 Left 1181039760 22:20186450-20186472 CCTCTGCTCACGCTCCTGTGCAG No data
Right 1181039769 22:20186469-20186491 GCAGGGAGGGACTTGAGGGTGGG No data
1181039760_1181039767 -8 Left 1181039760 22:20186450-20186472 CCTCTGCTCACGCTCCTGTGCAG No data
Right 1181039767 22:20186465-20186487 CTGTGCAGGGAGGGACTTGAGGG No data
1181039760_1181039770 1 Left 1181039760 22:20186450-20186472 CCTCTGCTCACGCTCCTGTGCAG No data
Right 1181039770 22:20186474-20186496 GAGGGACTTGAGGGTGGGCCTGG No data
1181039760_1181039768 -5 Left 1181039760 22:20186450-20186472 CCTCTGCTCACGCTCCTGTGCAG No data
Right 1181039768 22:20186468-20186490 TGCAGGGAGGGACTTGAGGGTGG No data
1181039760_1181039773 12 Left 1181039760 22:20186450-20186472 CCTCTGCTCACGCTCCTGTGCAG No data
Right 1181039773 22:20186485-20186507 GGGTGGGCCTGGGGAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181039760 Original CRISPR CTGCACAGGAGCGTGAGCAG AGG (reversed) Intergenic