ID: 1181039765

View in Genome Browser
Species Human (GRCh38)
Location 22:20186464-20186486
Sequence CCTCAAGTCCCTCCCTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181039765_1181039775 6 Left 1181039765 22:20186464-20186486 CCTGTGCAGGGAGGGACTTGAGG No data
Right 1181039775 22:20186493-20186515 CTGGGGAAACTGTGGAAAGTAGG No data
1181039765_1181039773 -2 Left 1181039765 22:20186464-20186486 CCTGTGCAGGGAGGGACTTGAGG No data
Right 1181039773 22:20186485-20186507 GGGTGGGCCTGGGGAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181039765 Original CRISPR CCTCAAGTCCCTCCCTGCAC AGG (reversed) Intergenic