ID: 1181039775

View in Genome Browser
Species Human (GRCh38)
Location 22:20186493-20186515
Sequence CTGGGGAAACTGTGGAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181039765_1181039775 6 Left 1181039765 22:20186464-20186486 CCTGTGCAGGGAGGGACTTGAGG No data
Right 1181039775 22:20186493-20186515 CTGGGGAAACTGTGGAAAGTAGG No data
1181039760_1181039775 20 Left 1181039760 22:20186450-20186472 CCTCTGCTCACGCTCCTGTGCAG No data
Right 1181039775 22:20186493-20186515 CTGGGGAAACTGTGGAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181039775 Original CRISPR CTGGGGAAACTGTGGAAAGT AGG Intergenic