ID: 1181042001

View in Genome Browser
Species Human (GRCh38)
Location 22:20196700-20196722
Sequence TGCAGTGAGCGAGACCCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181042001_1181042008 28 Left 1181042001 22:20196700-20196722 CCCACGGGGTCTCGCTCACTGCA No data
Right 1181042008 22:20196751-20196773 TGGCCTTGAGAATTCCTCTCTGG No data
1181042001_1181042006 8 Left 1181042001 22:20196700-20196722 CCCACGGGGTCTCGCTCACTGCA No data
Right 1181042006 22:20196731-20196753 CTGCTGCTGCTGTCGGTCCTTGG No data
1181042001_1181042009 29 Left 1181042001 22:20196700-20196722 CCCACGGGGTCTCGCTCACTGCA No data
Right 1181042009 22:20196752-20196774 GGCCTTGAGAATTCCTCTCTGGG No data
1181042001_1181042005 1 Left 1181042001 22:20196700-20196722 CCCACGGGGTCTCGCTCACTGCA No data
Right 1181042005 22:20196724-20196746 GCGGGCTCTGCTGCTGCTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181042001 Original CRISPR TGCAGTGAGCGAGACCCCGT GGG (reversed) Intergenic
No off target data available for this crispr