ID: 1181043229

View in Genome Browser
Species Human (GRCh38)
Location 22:20202769-20202791
Sequence CTGTGGGACTGCAGGGGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181043218_1181043229 3 Left 1181043218 22:20202743-20202765 CCAGTCGCAGATGCCCTTGGCAG No data
Right 1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG No data
1181043216_1181043229 17 Left 1181043216 22:20202729-20202751 CCGCGGTGGAGTTTCCAGTCGCA No data
Right 1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG No data
1181043224_1181043229 -10 Left 1181043224 22:20202756-20202778 CCCTTGGCAGGGGCTGTGGGACT No data
Right 1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181043229 Original CRISPR CTGTGGGACTGCAGGGGAGA CGG Intergenic
No off target data available for this crispr