ID: 1181043501

View in Genome Browser
Species Human (GRCh38)
Location 22:20203960-20203982
Sequence CTGTGGAATGGGAAGTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181043490_1181043501 -6 Left 1181043490 22:20203943-20203965 CCCTGCCCTGTGGAGGCCTGTGG No data
Right 1181043501 22:20203960-20203982 CTGTGGAATGGGAAGTGGGGAGG No data
1181043481_1181043501 26 Left 1181043481 22:20203911-20203933 CCTCTCCGAACTTCTGTCACCCC No data
Right 1181043501 22:20203960-20203982 CTGTGGAATGGGAAGTGGGGAGG No data
1181043485_1181043501 6 Left 1181043485 22:20203931-20203953 CCCTGTCACGGCCCCTGCCCTGT No data
Right 1181043501 22:20203960-20203982 CTGTGGAATGGGAAGTGGGGAGG No data
1181043486_1181043501 5 Left 1181043486 22:20203932-20203954 CCTGTCACGGCCCCTGCCCTGTG No data
Right 1181043501 22:20203960-20203982 CTGTGGAATGGGAAGTGGGGAGG No data
1181043489_1181043501 -5 Left 1181043489 22:20203942-20203964 CCCCTGCCCTGTGGAGGCCTGTG No data
Right 1181043501 22:20203960-20203982 CTGTGGAATGGGAAGTGGGGAGG No data
1181043492_1181043501 -7 Left 1181043492 22:20203944-20203966 CCTGCCCTGTGGAGGCCTGTGGA No data
Right 1181043501 22:20203960-20203982 CTGTGGAATGGGAAGTGGGGAGG No data
1181043484_1181043501 7 Left 1181043484 22:20203930-20203952 CCCCTGTCACGGCCCCTGCCCTG No data
Right 1181043501 22:20203960-20203982 CTGTGGAATGGGAAGTGGGGAGG No data
1181043482_1181043501 21 Left 1181043482 22:20203916-20203938 CCGAACTTCTGTCACCCCTGTCA No data
Right 1181043501 22:20203960-20203982 CTGTGGAATGGGAAGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181043501 Original CRISPR CTGTGGAATGGGAAGTGGGG AGG Intergenic
No off target data available for this crispr