ID: 1181043713

View in Genome Browser
Species Human (GRCh38)
Location 22:20204822-20204844
Sequence TGCACCAGAGGCTGCCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181043713_1181043727 25 Left 1181043713 22:20204822-20204844 CCCTGGTGGCAGCCTCTGGTGCA No data
Right 1181043727 22:20204870-20204892 TCACAGGGACCCTGTGTGCCAGG No data
1181043713_1181043721 9 Left 1181043713 22:20204822-20204844 CCCTGGTGGCAGCCTCTGGTGCA No data
Right 1181043721 22:20204854-20204876 GGGCAGCCCCTCCTCATCACAGG No data
1181043713_1181043722 10 Left 1181043713 22:20204822-20204844 CCCTGGTGGCAGCCTCTGGTGCA No data
Right 1181043722 22:20204855-20204877 GGCAGCCCCTCCTCATCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181043713 Original CRISPR TGCACCAGAGGCTGCCACCA GGG (reversed) Intergenic