ID: 1181045851

View in Genome Browser
Species Human (GRCh38)
Location 22:20213938-20213960
Sequence GTGGGGCGCATGGCGGCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181045851_1181045859 -7 Left 1181045851 22:20213938-20213960 CCCCCGGCCGCCATGCGCCCCAC No data
Right 1181045859 22:20213954-20213976 GCCCCACCGCGGGTGTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181045851 Original CRISPR GTGGGGCGCATGGCGGCCGG GGG (reversed) Intergenic