ID: 1181045972

View in Genome Browser
Species Human (GRCh38)
Location 22:20214418-20214440
Sequence CCTGCAGGCGGGAATCTGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181045972_1181045983 11 Left 1181045972 22:20214418-20214440 CCGCTCAGATTCCCGCCTGCAGG No data
Right 1181045983 22:20214452-20214474 GGGCTGCTGAGGACCGACCAAGG No data
1181045972_1181045980 0 Left 1181045972 22:20214418-20214440 CCGCTCAGATTCCCGCCTGCAGG No data
Right 1181045980 22:20214441-20214463 TCCCTGTCACGGGGCTGCTGAGG No data
1181045972_1181045977 -10 Left 1181045972 22:20214418-20214440 CCGCTCAGATTCCCGCCTGCAGG No data
Right 1181045977 22:20214431-20214453 CGCCTGCAGGTCCCTGTCACGGG No data
1181045972_1181045978 -9 Left 1181045972 22:20214418-20214440 CCGCTCAGATTCCCGCCTGCAGG No data
Right 1181045978 22:20214432-20214454 GCCTGCAGGTCCCTGTCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181045972 Original CRISPR CCTGCAGGCGGGAATCTGAG CGG (reversed) Intergenic
No off target data available for this crispr