ID: 1181046710

View in Genome Browser
Species Human (GRCh38)
Location 22:20218069-20218091
Sequence ACCGGGGTCCAGCTGGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181046710_1181046718 19 Left 1181046710 22:20218069-20218091 CCTGTCACCAGCTGGACCCCGGT No data
Right 1181046718 22:20218111-20218133 ACCTGCCTTCACATGGTTTCTGG No data
1181046710_1181046717 12 Left 1181046710 22:20218069-20218091 CCTGTCACCAGCTGGACCCCGGT No data
Right 1181046717 22:20218104-20218126 CTGTCTCACCTGCCTTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181046710 Original CRISPR ACCGGGGTCCAGCTGGTGAC AGG (reversed) Intergenic
No off target data available for this crispr