ID: 1181047803

View in Genome Browser
Species Human (GRCh38)
Location 22:20223848-20223870
Sequence TCCAGCTGGGCCCCAGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181047789_1181047803 15 Left 1181047789 22:20223810-20223832 CCCTGCTGCCCATGTGTGAGGAC No data
Right 1181047803 22:20223848-20223870 TCCAGCTGGGCCCCAGGCTCAGG No data
1181047787_1181047803 21 Left 1181047787 22:20223804-20223826 CCGCATCCCTGCTGCCCATGTGT No data
Right 1181047803 22:20223848-20223870 TCCAGCTGGGCCCCAGGCTCAGG No data
1181047794_1181047803 6 Left 1181047794 22:20223819-20223841 CCATGTGTGAGGACCCGGGCTGC No data
Right 1181047803 22:20223848-20223870 TCCAGCTGGGCCCCAGGCTCAGG No data
1181047790_1181047803 14 Left 1181047790 22:20223811-20223833 CCTGCTGCCCATGTGTGAGGACC No data
Right 1181047803 22:20223848-20223870 TCCAGCTGGGCCCCAGGCTCAGG No data
1181047797_1181047803 -7 Left 1181047797 22:20223832-20223854 CCCGGGCTGCCAGGGCTCCAGCT No data
Right 1181047803 22:20223848-20223870 TCCAGCTGGGCCCCAGGCTCAGG No data
1181047793_1181047803 7 Left 1181047793 22:20223818-20223840 CCCATGTGTGAGGACCCGGGCTG No data
Right 1181047803 22:20223848-20223870 TCCAGCTGGGCCCCAGGCTCAGG No data
1181047798_1181047803 -8 Left 1181047798 22:20223833-20223855 CCGGGCTGCCAGGGCTCCAGCTG No data
Right 1181047803 22:20223848-20223870 TCCAGCTGGGCCCCAGGCTCAGG No data
1181047786_1181047803 22 Left 1181047786 22:20223803-20223825 CCCGCATCCCTGCTGCCCATGTG No data
Right 1181047803 22:20223848-20223870 TCCAGCTGGGCCCCAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181047803 Original CRISPR TCCAGCTGGGCCCCAGGCTC AGG Intergenic
No off target data available for this crispr