ID: 1181049502

View in Genome Browser
Species Human (GRCh38)
Location 22:20231877-20231899
Sequence CTGGACACCTGTGGAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181049502_1181049507 0 Left 1181049502 22:20231877-20231899 CCTGTCTTTCCACAGGTGTCCAG No data
Right 1181049507 22:20231900-20231922 GGTCACTCCCACCCCACCCTTGG No data
1181049502_1181049511 11 Left 1181049502 22:20231877-20231899 CCTGTCTTTCCACAGGTGTCCAG No data
Right 1181049511 22:20231911-20231933 CCCCACCCTTGGCCTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181049502 Original CRISPR CTGGACACCTGTGGAAAGAC AGG (reversed) Intergenic
No off target data available for this crispr