ID: 1181051020

View in Genome Browser
Species Human (GRCh38)
Location 22:20238309-20238331
Sequence GGGGCGGGCCACTGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181051020_1181051035 28 Left 1181051020 22:20238309-20238331 CCGCCGCCGCAGTGGCCCGCCCC No data
Right 1181051035 22:20238360-20238382 CCTCCCTCTCAACTTGTTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181051020 Original CRISPR GGGGCGGGCCACTGCGGCGG CGG (reversed) Intergenic
No off target data available for this crispr