ID: 1181051035

View in Genome Browser
Species Human (GRCh38)
Location 22:20238360-20238382
Sequence CCTCCCTCTCAACTTGTTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181051030_1181051035 2 Left 1181051030 22:20238335-20238357 CCCCAGCTCACACCACAAACACT No data
Right 1181051035 22:20238360-20238382 CCTCCCTCTCAACTTGTTTCCGG No data
1181051031_1181051035 1 Left 1181051031 22:20238336-20238358 CCCAGCTCACACCACAAACACTT No data
Right 1181051035 22:20238360-20238382 CCTCCCTCTCAACTTGTTTCCGG No data
1181051028_1181051035 8 Left 1181051028 22:20238329-20238351 CCCGGGCCCCAGCTCACACCACA No data
Right 1181051035 22:20238360-20238382 CCTCCCTCTCAACTTGTTTCCGG No data
1181051022_1181051035 25 Left 1181051022 22:20238312-20238334 CCGCCGCAGTGGCCCGCCCCGGG No data
Right 1181051035 22:20238360-20238382 CCTCCCTCTCAACTTGTTTCCGG No data
1181051026_1181051035 12 Left 1181051026 22:20238325-20238347 CCGCCCCGGGCCCCAGCTCACAC No data
Right 1181051035 22:20238360-20238382 CCTCCCTCTCAACTTGTTTCCGG No data
1181051033_1181051035 -10 Left 1181051033 22:20238347-20238369 CCACAAACACTTGCCTCCCTCTC No data
Right 1181051035 22:20238360-20238382 CCTCCCTCTCAACTTGTTTCCGG No data
1181051024_1181051035 22 Left 1181051024 22:20238315-20238337 CCGCAGTGGCCCGCCCCGGGCCC No data
Right 1181051035 22:20238360-20238382 CCTCCCTCTCAACTTGTTTCCGG No data
1181051032_1181051035 0 Left 1181051032 22:20238337-20238359 CCAGCTCACACCACAAACACTTG No data
Right 1181051035 22:20238360-20238382 CCTCCCTCTCAACTTGTTTCCGG No data
1181051029_1181051035 7 Left 1181051029 22:20238330-20238352 CCGGGCCCCAGCTCACACCACAA No data
Right 1181051035 22:20238360-20238382 CCTCCCTCTCAACTTGTTTCCGG No data
1181051025_1181051035 13 Left 1181051025 22:20238324-20238346 CCCGCCCCGGGCCCCAGCTCACA No data
Right 1181051035 22:20238360-20238382 CCTCCCTCTCAACTTGTTTCCGG No data
1181051027_1181051035 9 Left 1181051027 22:20238328-20238350 CCCCGGGCCCCAGCTCACACCAC No data
Right 1181051035 22:20238360-20238382 CCTCCCTCTCAACTTGTTTCCGG No data
1181051020_1181051035 28 Left 1181051020 22:20238309-20238331 CCGCCGCCGCAGTGGCCCGCCCC No data
Right 1181051035 22:20238360-20238382 CCTCCCTCTCAACTTGTTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181051035 Original CRISPR CCTCCCTCTCAACTTGTTTC CGG Intergenic
No off target data available for this crispr