ID: 1181051396

View in Genome Browser
Species Human (GRCh38)
Location 22:20239862-20239884
Sequence GCAGCTAAACTGCTGGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181051396_1181051405 8 Left 1181051396 22:20239862-20239884 CCCAGATCCAGCAGTTTAGCTGC No data
Right 1181051405 22:20239893-20239915 AGGCATGACAGGGGCCACTTGGG No data
1181051396_1181051401 -2 Left 1181051396 22:20239862-20239884 CCCAGATCCAGCAGTTTAGCTGC No data
Right 1181051401 22:20239883-20239905 GCCTCTTCTCAGGCATGACAGGG No data
1181051396_1181051404 7 Left 1181051396 22:20239862-20239884 CCCAGATCCAGCAGTTTAGCTGC No data
Right 1181051404 22:20239892-20239914 CAGGCATGACAGGGGCCACTTGG No data
1181051396_1181051403 -1 Left 1181051396 22:20239862-20239884 CCCAGATCCAGCAGTTTAGCTGC No data
Right 1181051403 22:20239884-20239906 CCTCTTCTCAGGCATGACAGGGG No data
1181051396_1181051400 -3 Left 1181051396 22:20239862-20239884 CCCAGATCCAGCAGTTTAGCTGC No data
Right 1181051400 22:20239882-20239904 TGCCTCTTCTCAGGCATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181051396 Original CRISPR GCAGCTAAACTGCTGGATCT GGG (reversed) Intergenic
No off target data available for this crispr