ID: 1181051507

View in Genome Browser
Species Human (GRCh38)
Location 22:20240289-20240311
Sequence GACCCTGTGCCTGTGCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181051507_1181051510 1 Left 1181051507 22:20240289-20240311 CCTGTGGGCACAGGCACAGGGTC No data
Right 1181051510 22:20240313-20240335 CTCAGGAGAGACAGGACATGTGG No data
1181051507_1181051512 5 Left 1181051507 22:20240289-20240311 CCTGTGGGCACAGGCACAGGGTC No data
Right 1181051512 22:20240317-20240339 GGAGAGACAGGACATGTGGGAGG No data
1181051507_1181051511 2 Left 1181051507 22:20240289-20240311 CCTGTGGGCACAGGCACAGGGTC No data
Right 1181051511 22:20240314-20240336 TCAGGAGAGACAGGACATGTGGG No data
1181051507_1181051514 17 Left 1181051507 22:20240289-20240311 CCTGTGGGCACAGGCACAGGGTC No data
Right 1181051514 22:20240329-20240351 CATGTGGGAGGACCCTGAGGAGG No data
1181051507_1181051509 -7 Left 1181051507 22:20240289-20240311 CCTGTGGGCACAGGCACAGGGTC No data
Right 1181051509 22:20240305-20240327 CAGGGTCTCTCAGGAGAGACAGG No data
1181051507_1181051515 18 Left 1181051507 22:20240289-20240311 CCTGTGGGCACAGGCACAGGGTC No data
Right 1181051515 22:20240330-20240352 ATGTGGGAGGACCCTGAGGAGGG No data
1181051507_1181051516 24 Left 1181051507 22:20240289-20240311 CCTGTGGGCACAGGCACAGGGTC No data
Right 1181051516 22:20240336-20240358 GAGGACCCTGAGGAGGGTACAGG No data
1181051507_1181051513 14 Left 1181051507 22:20240289-20240311 CCTGTGGGCACAGGCACAGGGTC No data
Right 1181051513 22:20240326-20240348 GGACATGTGGGAGGACCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181051507 Original CRISPR GACCCTGTGCCTGTGCCCAC AGG (reversed) Intergenic
No off target data available for this crispr