ID: 1181052935

View in Genome Browser
Species Human (GRCh38)
Location 22:20246260-20246282
Sequence TGCGGCAGCCAGACTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 382}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181052924_1181052935 19 Left 1181052924 22:20246218-20246240 CCAGCGGGGACAGTGACCGGATA No data
Right 1181052935 22:20246260-20246282 TGCGGCAGCCAGACTGGGCAGGG 0: 1
1: 0
2: 4
3: 32
4: 382
1181052923_1181052935 20 Left 1181052923 22:20246217-20246239 CCCAGCGGGGACAGTGACCGGAT 0: 1
1: 0
2: 2
3: 4
4: 127
Right 1181052935 22:20246260-20246282 TGCGGCAGCCAGACTGGGCAGGG 0: 1
1: 0
2: 4
3: 32
4: 382
1181052928_1181052935 -9 Left 1181052928 22:20246246-20246268 CCAGAGCCTCTCCCTGCGGCAGC 0: 1
1: 0
2: 5
3: 32
4: 369
Right 1181052935 22:20246260-20246282 TGCGGCAGCCAGACTGGGCAGGG 0: 1
1: 0
2: 4
3: 32
4: 382
1181052925_1181052935 3 Left 1181052925 22:20246234-20246256 CCGGATACTGACCCAGAGCCTCT No data
Right 1181052935 22:20246260-20246282 TGCGGCAGCCAGACTGGGCAGGG 0: 1
1: 0
2: 4
3: 32
4: 382
1181052927_1181052935 -8 Left 1181052927 22:20246245-20246267 CCCAGAGCCTCTCCCTGCGGCAG 0: 1
1: 0
2: 1
3: 31
4: 251
Right 1181052935 22:20246260-20246282 TGCGGCAGCCAGACTGGGCAGGG 0: 1
1: 0
2: 4
3: 32
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181052935 Original CRISPR TGCGGCAGCCAGACTGGGCA GGG Intronic
900280368 1:1863423-1863445 GGCAGCAGCCACAGTGGGCAAGG - Intronic
901633678 1:10659848-10659870 TGCGGGAGCCAGGCTGGGGGTGG + Exonic
903179972 1:21600294-21600316 TGCAGGAGCCAGAGTGGGGAGGG - Intronic
903540769 1:24095025-24095047 TGAGGCAGCCAGCCTGGCCTGGG + Intronic
905754181 1:40494102-40494124 TGCTGCTGCCAGAGTGGGGAGGG + Intronic
906662426 1:47592699-47592721 TTCGGCACCCAGAGTGGGCAAGG - Intergenic
906760135 1:48369489-48369511 GGCGGCAGCCAGGCTGGGGGAGG - Intronic
908099728 1:60778241-60778263 TGCGGCAGCAAGGCTGGGGGAGG - Intergenic
908898111 1:68923904-68923926 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
908977065 1:69910910-69910932 GGCGGCAGCGAGGCTGGGGAAGG - Intronic
910311603 1:85830510-85830532 GGCGGCAGCCAGGCTGGGGGAGG - Intronic
911334243 1:96561769-96561791 TACGGCATCCAGGCCGGGCATGG - Intergenic
912720024 1:112012189-112012211 TGCAGCAGAGAGCCTGGGCAAGG + Intergenic
915300480 1:154948540-154948562 TCCTGCCTCCAGACTGGGCAGGG - Intronic
917827411 1:178837961-178837983 GGCGGCAGCGAGGCTGGGGAAGG + Intronic
918238896 1:182604499-182604521 GCCCGCAGCCAGACTGGGCCGGG + Intergenic
919996280 1:202754076-202754098 TTCGTCTGCCAGAATGGGCAAGG - Intronic
920203799 1:204277041-204277063 TGAGGCTGCCAAACTGGGGACGG - Intronic
920359730 1:205406419-205406441 GGCGGCAGCCAGGCTGGGGGAGG - Intronic
921243714 1:213214309-213214331 GGCGGCAGCGAGGCTGGGGAAGG + Intronic
922731850 1:227952625-227952647 TGAGGAATCCAGACTGGGCCTGG - Intergenic
1064761690 10:18627811-18627833 GGCGGCAGCCAGGCTGGGGGAGG + Intronic
1064914552 10:20441912-20441934 GGCGGCAGCGAGACTGGGGGAGG - Intergenic
1064922183 10:20531405-20531427 GGCGGCAGCCAGGCTGGGGGAGG - Intergenic
1065276899 10:24094947-24094969 GGCGGCAGCCAGGCTGGGGGAGG - Intronic
1065319640 10:24497440-24497462 AGTGACAGCCAGGCTGGGCATGG + Intronic
1065887255 10:30089396-30089418 TGGGGCAGCCAGACTGAGCAGGG - Intronic
1066152857 10:32642358-32642380 GGCGGCAGCCAGGCTGGGGGAGG - Intronic
1066623158 10:37379569-37379591 TGGGGCAACCAGACTGGCTATGG - Intronic
1067121209 10:43473732-43473754 TACAACAGCCAGGCTGGGCAAGG + Intronic
1067166001 10:43867188-43867210 GGTTGCAGCCAGACTGGGGAGGG - Intergenic
1068339995 10:55688655-55688677 GGCGGCAGCGAGGCTGGGGAGGG - Intergenic
1069259940 10:66382358-66382380 GGCGGCAGCCTGGCTGGGGAAGG + Intronic
1071329574 10:84546406-84546428 AGTGACAGCCAGACTGGGCAGGG + Intergenic
1071748035 10:88443754-88443776 TGCGGCAGTGAGGCTGGGGAAGG + Intronic
1072757240 10:98029732-98029754 TGGGGCAGCCAGGCCGGGCTTGG - Intronic
1073060666 10:100731563-100731585 TGCAGCGGCCAGGCTTGGCAGGG + Intergenic
1073247026 10:102098350-102098372 AGCTGGAGCCAGACTGGACAAGG - Intergenic
1073945118 10:108741167-108741189 GGCAGCAGCCTGACTGGGCTTGG - Intergenic
1074086254 10:110210474-110210496 CTCTGCAGCCAAACTGGGCACGG - Intronic
1076250854 10:128982788-128982810 TGAGCCAGGCAGACTGAGCAGGG + Intergenic
1077473357 11:2775154-2775176 TGGAGCAGCCAGGCTGAGCAGGG - Intronic
1077788548 11:5412719-5412741 GGCGGCAGCCAGGCTGGGGGAGG + Intronic
1078085937 11:8233057-8233079 TGCAGAGGCCAGCCTGGGCACGG - Intronic
1078508239 11:11967516-11967538 TCCTGCAGCCACACAGGGCATGG + Intronic
1078689006 11:13560548-13560570 GGCGGCAGCCAGGCTGGGGGAGG - Intergenic
1079286225 11:19135477-19135499 GGCGGCAGCGAGGCTGGGGAGGG + Intronic
1079598679 11:22285223-22285245 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1079629149 11:22652509-22652531 GGCGGCAGCCAGGCTGGGGAAGG - Intronic
1080059224 11:27939485-27939507 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1080082566 11:28238319-28238341 GGCGGCAGCCAGGCTGGGGGAGG - Intronic
1081427449 11:42940749-42940771 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1081778367 11:45692822-45692844 GGAGGCAGCCAGACTCGGCAGGG - Intergenic
1081907075 11:46676952-46676974 AGCGGCAGACGGACTGGGGAGGG + Intergenic
1083147282 11:60768872-60768894 TGCTGGAGGCAGCCTGGGCAGGG - Intronic
1083523037 11:63333838-63333860 GGCGGCAGCAAGACTGGGGGAGG - Intronic
1083629284 11:64087452-64087474 TCTGGGAACCAGACTGGGCAGGG + Intronic
1084768242 11:71326125-71326147 GGCGGAAGCCAGCCTGGGCCTGG + Intergenic
1085261107 11:75205192-75205214 TGGGACACCCAGACTTGGCAGGG + Exonic
1087086181 11:94220952-94220974 TGCTGCAGCCAAAATGTGCAGGG - Intergenic
1087451588 11:98330487-98330509 GGCGGCAGCCAGGCTGGGGGAGG - Intergenic
1088250562 11:107858223-107858245 CGAGCCAGCCAGACTGGGCGCGG - Intronic
1089445960 11:118552501-118552523 TGCTGCAGCCAGGCCAGGCATGG + Intronic
1091032632 11:132204692-132204714 GGCGGCATCCAGAGTGTGCAAGG + Intronic
1091795289 12:3294493-3294515 TGCCAGAGCCAGCCTGGGCAGGG - Intergenic
1094387425 12:29910320-29910342 TGCAGCAGCGAGGCTGGGGAAGG + Intergenic
1094451645 12:30588772-30588794 AGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1094877963 12:34672663-34672685 GGCGGCAGCCAGGCTGGGGGAGG - Intergenic
1095225064 12:39669759-39669781 GGCGGCAGCCAGGCTGGGAGGGG - Intronic
1096127682 12:49131502-49131524 TGCGGCGGCCAGGCCGGGCGCGG - Intergenic
1096275848 12:50207596-50207618 TGAGGAAGTGAGACTGGGCATGG + Intronic
1097050653 12:56221390-56221412 TCCGGGGGCCAGCCTGGGCAGGG - Intronic
1097054496 12:56241593-56241615 GATGGCAGCCAAACTGGGCAAGG + Exonic
1098665225 12:73153206-73153228 GGCGGCAGCCAGGCTGGGTGAGG - Intergenic
1099146121 12:79045209-79045231 GGCGGCAGCCAGGCTGGGGGAGG - Intronic
1099235703 12:80080388-80080410 GGCGGCAGCCAGGCTGGGGGAGG - Intergenic
1100396646 12:94191491-94191513 ATAGGCATCCAGACTGGGCATGG + Intronic
1100563836 12:95775614-95775636 GGCGGCAGCCAGGCTGGGGGAGG + Intronic
1100861364 12:98810715-98810737 TCAGGCAGGCAGACTGGGCATGG - Intronic
1103449316 12:121017014-121017036 TGCAGAATCCAGGCTGGGCACGG + Intergenic
1104216520 12:126739233-126739255 TGAGGCAAGCAGTCTGGGCATGG + Intergenic
1104748831 12:131225608-131225630 GGCGGCTCCCAGCCTGGGCAGGG - Intergenic
1104758029 12:131281057-131281079 TTCAGCACCCAGACTGTGCAGGG - Intergenic
1104784292 12:131439956-131439978 GGCGGCTCCCAGCCTGGGCAGGG + Intergenic
1107231199 13:38112549-38112571 GGTGGCAGCGAGACTGGGGAAGG + Intergenic
1107726623 13:43305955-43305977 TGCGCAGGCCAGGCTGGGCAGGG - Intronic
1111498692 13:89088297-89088319 GGCGGCAGCCAGACTGGGGGAGG + Intergenic
1112527172 13:100161202-100161224 TGTGGCATCCAGTGTGGGCAAGG + Intronic
1113424087 13:110193650-110193672 TGCGGCTGCCAGCCAGGGCAGGG - Intronic
1113492424 13:110703034-110703056 AGTTGCAGCCAGACTGGGGAGGG - Intronic
1114171843 14:20280464-20280486 GGCGGCAGCCAGGCTGGGGGAGG + Intronic
1114195070 14:20469701-20469723 TGCGGCAGCCAGCGCGGGCAGGG + Intronic
1114751559 14:25210125-25210147 GGCGGCAGCCAGGCTGGGGGAGG - Intergenic
1115868267 14:37772392-37772414 GGCGGCAGCGAGGCTGGGGAAGG - Intronic
1116042592 14:39703301-39703323 GGCGGCAGCCAGGCTGGGGGAGG - Intergenic
1116322830 14:43492593-43492615 AGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1116570395 14:46508976-46508998 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1116667329 14:47795043-47795065 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1116675514 14:47901597-47901619 GGCGGCAGCCAGGCTGGGGTAGG + Intergenic
1117170041 14:53085050-53085072 GGCGGCAGCCTGGCTGGGGAAGG + Intronic
1118259712 14:64235617-64235639 TGCCGCAGCCAGCCATGGCAGGG + Intronic
1119652970 14:76396814-76396836 TGCAGCAGCCAGGCTCGGCCTGG + Intronic
1120042348 14:79768176-79768198 GGCAGCAGCCAGACTGGGGGAGG + Intronic
1121423784 14:93833848-93833870 TGTGACAGACAGACAGGGCATGG - Intergenic
1121485848 14:94313761-94313783 TGAAGCAGCCAGACTGTTCATGG + Intronic
1121699349 14:95940622-95940644 TGCAGCAGCAAGTCAGGGCAGGG - Intergenic
1122252448 14:100449458-100449480 TGCAACAGCCAGCCAGGGCAGGG - Intronic
1122743916 14:103887152-103887174 GGGGGCAGCCAGGCTGGGCTTGG - Intergenic
1122872243 14:104644319-104644341 TGTGGCACCCACACTGGGAAGGG + Intergenic
1123071033 14:105642652-105642674 TGCGGGTGCGAGGCTGGGCAGGG + Intergenic
1123075993 14:105667693-105667715 TGCGGGTGCGAGGCTGGGCAGGG + Intergenic
1123090696 14:105740922-105740944 TGCGGGTGCGAGGCTGGGCAGGG + Intergenic
1123096328 14:105768686-105768708 TGCGGGTGCGAGGCTGGGCAGGG + Intergenic
1124751655 15:32375127-32375149 TGAGGCTGGCAGGCTGGGCAGGG - Intergenic
1125600049 15:40910535-40910557 TGCGGAGGCCAGGCTGGGCCAGG - Intergenic
1125779492 15:42251962-42251984 GGTGGCAGCCAGGCTGGGGAAGG - Intronic
1126211436 15:46104950-46104972 GGCGGCAGCGAGGCTGGGGAAGG + Intergenic
1126493496 15:49265284-49265306 GGCGGCAGCCAGGCTGGGGGAGG - Intronic
1126922254 15:53541046-53541068 GGCGGCAGCCAGGCTGGGGGAGG + Intronic
1126933852 15:53684613-53684635 GGCGGCAGCCAGGCTGGGGGAGG + Intronic
1127325786 15:57894025-57894047 TGATGCATCCAGACTGAGCAAGG - Intergenic
1127708034 15:61566640-61566662 TGAGGAAGCAGGACTGGGCAAGG + Intergenic
1128343136 15:66836646-66836668 TGTGTGAGCCAGGCTGGGCAGGG - Intergenic
1128536298 15:68493174-68493196 TGCTGCTGACAGACTGGGAAGGG + Intergenic
1128882653 15:71257647-71257669 TGGGGAAGCCAAACTGTGCAAGG + Intronic
1128904811 15:71457431-71457453 AGCCCCAGCCAGAATGGGCAAGG - Intronic
1129737470 15:77974214-77974236 TGGTGCAGGCAGCCTGGGCATGG + Intergenic
1129893913 15:79090029-79090051 TGCGGCGGGCAGAGGGGGCAGGG - Intronic
1130556736 15:84928123-84928145 TGGGGAAGCCAGACTGCCCAGGG - Intronic
1130715571 15:86330110-86330132 GGCAGCAGCCACAGTGGGCAGGG - Intronic
1130806887 15:87332978-87333000 CGCGGCAGCAAGGCTGGGGAGGG - Intergenic
1130947448 15:88559828-88559850 GGCGGCAGCGAGACTGGGGGAGG - Intergenic
1131254705 15:90854441-90854463 TTGGGAAGCCAGAATGGGCACGG + Intergenic
1132559921 16:589005-589027 TGCGGCAGCCGGGCCCGGCAGGG + Intergenic
1134136143 16:11677534-11677556 TGCGGCAGGGAGCCGGGGCAGGG + Exonic
1136289186 16:29261410-29261432 TGCAGCAGCCAGACTTCGTAAGG + Intergenic
1136477047 16:30519998-30520020 TGAGACAGCCAGGCTGGGGAAGG + Intronic
1137000444 16:35225186-35225208 TGCAGCAGCCAGCCTGGGCGAGG + Intergenic
1138762832 16:59564881-59564903 GGCGGCAGCAAGGCTGGGAAAGG - Intergenic
1139256952 16:65551536-65551558 GGCGGCAGCAAGGCTGGGGAAGG + Intergenic
1141462410 16:84185380-84185402 TGAGGCAGCCAGAGTGAGCGAGG + Intronic
1141724776 16:85780559-85780581 TGCCCCAGCCAGCGTGGGCACGG - Intronic
1142007080 16:87694453-87694475 TGTGGCATCCAGGCTAGGCAAGG + Intronic
1142094913 16:88234337-88234359 TGCAGCAGCCAGACTTTGTAAGG + Intergenic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1143408461 17:6694096-6694118 TTCCGCAGCCAGACTGAGGAAGG - Exonic
1147369038 17:39979097-39979119 TGAGGGAACCAGGCTGGGCAGGG - Intergenic
1148069726 17:44901443-44901465 TGAGGCAGCTAGACTTTGCATGG - Intronic
1148148048 17:45378489-45378511 GCCAGCAGCCAGACTGGGAAAGG - Intergenic
1148209859 17:45801578-45801600 TGGGGCTGCCAGGCTGTGCACGG + Intronic
1148407007 17:47424197-47424219 GGCGGCAGCCAGGCTGTGCAGGG + Intronic
1148644199 17:49210140-49210162 TGCGGCAGCAAGAGGGGTCAGGG - Intronic
1148853427 17:50565731-50565753 TGCGGCTGCCAGGCTAAGCAAGG + Intronic
1152095645 17:78270104-78270126 TTCTGCAGCCAGAGTGAGCAAGG + Intergenic
1152324918 17:79630299-79630321 TGCCGTATCCAGTCTGGGCACGG - Intergenic
1152703729 17:81832654-81832676 GGCGGGAGCCATACGGGGCACGG - Intronic
1152906440 17:82973056-82973078 CGCGGCTGCCAGCCTGGACAGGG + Intronic
1152938245 17:83152876-83152898 TGCCGCAGCCAGGCTGGCCGTGG + Intergenic
1153626103 18:7023628-7023650 TGCGGCATCCGGAGTGGTCAGGG - Intronic
1155597967 18:27510426-27510448 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1155675291 18:28422130-28422152 GGCGGCAGCCAGGCTGGGGGAGG - Intergenic
1156678962 18:39566009-39566031 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1157281326 18:46348116-46348138 TGCGGCAGACATCCTGGGGAGGG + Intronic
1157506232 18:48228605-48228627 GGCGGCAACCACAGTGGGCAAGG - Intronic
1158320964 18:56264101-56264123 TGTGTCAGCCTGACTGGGCTAGG + Intergenic
1158432123 18:57398716-57398738 TGGGGCATCAAGACTGGGGATGG + Intergenic
1158725724 18:59969751-59969773 GGCGGCAGCCAGGCTGTGCAGGG + Intergenic
1160727014 19:621853-621875 TGCGACAGGCAGACGGGTCAGGG + Intronic
1160876056 19:1296688-1296710 AGCCGCACCCAGACTGGGTAGGG + Intronic
1160951047 19:1667588-1667610 TGGGGCGGCCAGGCTGGGCCCGG - Intergenic
1163383740 19:16986221-16986243 TGCTGGGGCCAGGCTGGGCATGG - Intronic
1164179437 19:22806714-22806736 TGTGGCTGCCAGGCTGGGGATGG + Intergenic
1165204374 19:34171700-34171722 TGTGGAAGCAAGACAGGGCAAGG + Intergenic
1165448093 19:35867909-35867931 TGCTGCATCCACAGTGGGCATGG + Intronic
1166661022 19:44647425-44647447 CGTGGCAGCCAGACTGGGCGCGG + Exonic
1167661911 19:50800198-50800220 AGTGGCTGCCAGACTGGACAAGG + Intronic
1167894259 19:52568548-52568570 TGCGGCAGCTTGACTGGTGATGG - Intronic
1167930518 19:52859670-52859692 TGCGGCAGCTTGACTGGTGATGG + Intergenic
1168300965 19:55404891-55404913 TTCTACAGCCTGACTGGGCATGG - Intronic
925990284 2:9249303-9249325 TGGGGCAGACAGACAGGCCACGG - Intronic
927283891 2:21336356-21336378 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
927490172 2:23516149-23516171 TCAGCCAGCCAGGCTGGGCAGGG - Intronic
929765487 2:44840623-44840645 TCAGGCTGCCACACTGGGCATGG + Intergenic
929977978 2:46653525-46653547 TGCTGCAGAAAGACTGGGCAGGG + Intergenic
930092257 2:47539712-47539734 TGCGGACGCCAGACTGCGAAGGG + Intronic
930095497 2:47563068-47563090 TGAGGCAGCCAAACAAGGCATGG + Intronic
930467646 2:51774783-51774805 GGCGGCAGCGAGGCTGGGGAAGG - Intergenic
930615315 2:53587439-53587461 GGCGGCAGCGAGGCTGGGCGAGG + Intronic
930972926 2:57419124-57419146 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
930987593 2:57609253-57609275 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
931443263 2:62306188-62306210 TTCGGCAGCCAGACTGTGTAGGG + Intergenic
931818649 2:65929903-65929925 GGCGGCAGCCAGGCTGGGGGAGG - Intergenic
931846223 2:66206735-66206757 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
931864162 2:66391546-66391568 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
932986635 2:76733716-76733738 TGCTGCACCCAGAGAGGGCATGG - Intergenic
932990604 2:76781341-76781363 GGCGGCAGCCAGGCTGGGGGAGG - Intronic
932991704 2:76796220-76796242 GGCGGCAGCCAGGCTGGGGGAGG + Intronic
933151371 2:78919177-78919199 TGCAGAAGCCAGCCTGGGCTGGG + Intergenic
933241957 2:79931906-79931928 TGGGGCAGTAAGACTGGGTAAGG - Intronic
933579015 2:84104054-84104076 GGCGGCAGCCAGGCTGGGGGAGG - Intergenic
934925450 2:98379133-98379155 TGCGGCAGAGAGACTGGGCTTGG + Intronic
935345082 2:102100305-102100327 AGAGGCAGCCAGGCTGGGCATGG - Intronic
937011708 2:118568765-118568787 TGAGGCAGGCAGGCTGGGGAGGG - Intergenic
937929902 2:127195933-127195955 TAGGGCAGCCAGAGTGGGCCGGG - Intronic
938061770 2:128260740-128260762 AGCAGCAGCCAGGCTGTGCAGGG + Intronic
938572223 2:132570964-132570986 TACGGCAGGCATCCTGGGCAGGG + Intronic
939924335 2:148154520-148154542 GGCGGCAGCCAGGCTGGGGGAGG - Intronic
941163577 2:162061976-162061998 TGTGGTCGCCAGCCTGGGCATGG + Intronic
942723627 2:178982868-178982890 GGCGGCAGCCAGGCTGGGGGAGG + Intronic
943789355 2:191914729-191914751 TGTGGTTGCCAGACTGGGGATGG + Intergenic
945162618 2:206908440-206908462 GGCGGCAGCAAGGCTGGGGAAGG + Intergenic
945822704 2:214684189-214684211 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
946047247 2:216831439-216831461 TGGAGGAGCCAGCCTGGGCAGGG + Intergenic
946179494 2:217941191-217941213 TGGGGAGGCCAAACTGGGCAGGG + Intronic
948274770 2:236699895-236699917 TGTGGCAGCAAGACTCGGGAGGG - Intergenic
948310484 2:236981989-236982011 GGAGGCAGCCAGGCTGGGGAGGG + Intergenic
948419660 2:237849158-237849180 GGCGGCAGCGAGGCTGGGAAGGG - Intergenic
949022390 2:241748900-241748922 TGCGGCAGCCGGGCTGGCCTCGG - Intronic
1171049025 20:21838498-21838520 TGTGGCAGGCAGAGTGGGGAAGG + Intergenic
1171071237 20:22070400-22070422 AGTGGCATCCAGGCTGGGCATGG - Intergenic
1172445894 20:34993260-34993282 TGTGGCGGTCACACTGGGCAGGG + Intronic
1173638374 20:44581024-44581046 TGCCGCAGCCAGCCTGGGAAAGG - Intronic
1174130533 20:48340822-48340844 TGCGGGAGGCAAGCTGGGCAGGG - Intergenic
1176310592 21:5146948-5146970 TGAGGAAGGCAGACAGGGCAGGG - Intronic
1176896307 21:14383025-14383047 TGAGGATGCCAGAGTGGGCAGGG - Intronic
1178843593 21:36156862-36156884 TGGGGGAGAGAGACTGGGCAGGG - Intronic
1178914245 21:36698132-36698154 TGCGGGAGCCGGACAGGGGAGGG + Intergenic
1179164915 21:38927798-38927820 TGGGGCAGCCAGTCTGGAAATGG - Intergenic
1179846463 21:44115087-44115109 TGAGGAAGGCAGACAGGGCAGGG + Intronic
1181052935 22:20246260-20246282 TGCGGCAGCCAGACTGGGCAGGG + Intronic
1181558545 22:23686261-23686283 TTCGGAAGCCAGAATGGGCAGGG + Intergenic
1182209593 22:28663700-28663722 GGCGGCAGCCAGGCTGGGGGAGG + Intronic
1183039504 22:35166089-35166111 GGCGGCAGCAAGGCTGGGGAGGG + Intergenic
1183366571 22:37410156-37410178 TGCGGCAAACAGACGGGGCAGGG + Intronic
1184513440 22:44946129-44946151 TGCTGGAGCCAGAGTGGTCACGG + Intronic
950450633 3:13063159-13063181 TGGGGAAGCCAGGCTGGGCGTGG - Intronic
950590700 3:13934287-13934309 TGGGGCAGTCAGCCTGGGCTTGG - Intergenic
950711885 3:14819103-14819125 TGGGGCAGTCAGCCTGGGCTTGG - Exonic
951071186 3:18330869-18330891 GGCGGCAGCCAGGCTGGGGGAGG - Intronic
951818576 3:26783513-26783535 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
952936906 3:38405812-38405834 GGCGGCAGCCAGGCTGGGGGAGG + Intronic
954050610 3:47973328-47973350 TGAGGCAGCCAGACTGGTCAGGG - Intronic
954708535 3:52493815-52493837 TGGGGCAGCCAGGCCAGGCAGGG + Intergenic
954807051 3:53226722-53226744 TGGGGCAGGCAGGCTGGGCAAGG - Intronic
955172610 3:56582122-56582144 GGCGGCAGCAAGGCTGGGGAGGG - Intronic
955255274 3:57324998-57325020 GGCGGCAGCGAGGCTGGGGAAGG + Intronic
955606498 3:60710700-60710722 GGCGGCAGCGAGGCTGGGGAAGG + Intronic
956690698 3:71875535-71875557 TGCTGCAGCCTGCCTGGGGATGG - Intergenic
957968000 3:87346078-87346100 GGCGGCAGCGAGACTGGGGGAGG - Intergenic
958726348 3:97910336-97910358 GGCGGCAGCCAGGCTGGGGGAGG - Intronic
959353412 3:105296636-105296658 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
960653937 3:119981622-119981644 GGCGGCAGCCTGGCTGGGGAAGG + Intronic
961542199 3:127607602-127607624 TGAGGGAGACAGACAGGGCATGG - Intronic
962745001 3:138390391-138390413 AGAGGCAGCCAGACTGGGGGAGG - Intronic
963299503 3:143582854-143582876 AGCAGAAGCCAGGCTGGGCAGGG + Intronic
963504629 3:146168245-146168267 TGCTGCAGTGAGACTGGGCATGG - Intergenic
963561902 3:146876201-146876223 TGCTGCCCCCAGACTGGGGAGGG - Intergenic
964118889 3:153162354-153162376 TGCGGCAGCCCGGGAGGGCAGGG - Exonic
964149457 3:153506820-153506842 GGCGGCAGCGAGGCTGGGGAAGG + Intergenic
964696273 3:159511176-159511198 GGCGGCAGCGAGGCTGGGCGAGG - Intronic
964715264 3:159714677-159714699 GGCGGCAGCAAGGCTGGGGAAGG + Intronic
965194138 3:165572747-165572769 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
967380864 3:188856126-188856148 TGCGGCAGTTATACTTGGCAAGG - Intronic
968726993 4:2252364-2252386 TGAGGCAGCCAGACAGGGCAGGG + Intronic
969321899 4:6417553-6417575 TGTGCCAGGCAGACTGGGCATGG - Intronic
969522260 4:7685303-7685325 TGTGGGAACCCGACTGGGCACGG + Intronic
969648039 4:8444944-8444966 TGGGGTTGCCACACTGGGCAGGG + Intronic
970241601 4:14015048-14015070 GGCGGCAGCCAGGCTGGGGGAGG - Intergenic
972917346 4:43897210-43897232 GGCGGCAGCAAGACTGGACGAGG - Intergenic
973682993 4:53340393-53340415 GGCGGCAGCGAGGCTGGGGAAGG + Intronic
973704956 4:53572107-53572129 AGTGGGAGCCACACTGGGCAAGG - Intronic
974398691 4:61372817-61372839 GGCGGCAGCGAGACTGGGGGAGG - Intronic
974418968 4:61646865-61646887 TTCGGCAGCCAGGCTGGGGGAGG - Intronic
975092822 4:70423617-70423639 GGCGGCAGCAAGGCTGGGGAAGG - Intergenic
976506466 4:85853191-85853213 GGCGGCAGCCTGGCTGGGGAAGG - Intronic
976899763 4:90158590-90158612 GGCGGCAGCCAGGCTGGGGAGGG - Intronic
976977269 4:91180518-91180540 GGCAGCAGCCAGGCTGGGGAAGG - Intronic
977333247 4:95664119-95664141 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
978591256 4:110327515-110327537 GGCGGCAGCAAGGCTGGGGAAGG - Intergenic
978641502 4:110876383-110876405 GGCGGCAGCGAGACTGGGGGAGG - Intergenic
978677519 4:111337362-111337384 TGCGGCAGCCAGGCTGGGGGAGG + Intergenic
979310527 4:119198067-119198089 GGCGGCAGCCTGGCTGGGAAGGG + Intronic
979640150 4:123004021-123004043 GGCGGCAGCGAGGCTGGGGAAGG - Intronic
980631933 4:135447953-135447975 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
982838859 4:160156897-160156919 CGCGGCAGCCAGGCTGGGGGAGG - Intergenic
985016186 4:185638473-185638495 TGCGGCAGCGAGACTGGGTCTGG + Intronic
985277521 4:188252234-188252256 AACGTCAGCCCGACTGGGCAAGG - Intergenic
985642051 5:1068144-1068166 CACGGCAGCCTGTCTGGGCAAGG - Intronic
986101502 5:4615843-4615865 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
987731688 5:21781431-21781453 AGCGGCAACCAGACCAGGCACGG + Intronic
990913846 5:60881568-60881590 GGCGGCAGCCAGGCTGGGGGAGG - Intronic
991265671 5:64714628-64714650 GGCGGCAGCCAGGCTGGGGGAGG - Intronic
991535602 5:67666540-67666562 AGCGGCAGCCAGGCTGGGGAGGG - Intergenic
993867600 5:93213561-93213583 GGCGGCAGCGAGGCTGGGGAGGG + Intergenic
994693556 5:103047156-103047178 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
995356727 5:111246268-111246290 GGGGGTAGACAGACTGGGCAGGG - Intronic
995392816 5:111657560-111657582 GGCTGCAGCCAGACTGTGAAGGG - Intergenic
995489829 5:112679229-112679251 GGCGGCAGCCTGGCTGGGGAAGG - Intergenic
996625751 5:125568389-125568411 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
997080474 5:130732510-130732532 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
997117258 5:131138623-131138645 GGCGGCAGCCAGGCTGGGGGAGG - Intergenic
998241718 5:140452153-140452175 GGCGGCAGCCAGGCTGGGGGAGG + Intronic
998370244 5:141656121-141656143 TGGGGCAGTCAGAAAGGGCAGGG + Intronic
999473137 5:151874053-151874075 TGAGGAAGCCAGGCTGGGGAAGG + Intronic
1000404589 5:160873938-160873960 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1001348825 5:170936003-170936025 GGCGGCAGCGAGGCTGGGGAAGG - Intronic
1001523511 5:172412719-172412741 TGCTGCAGACAGCCTGGGCCTGG - Intronic
1002234112 5:177791877-177791899 GGCGGCAGCGAGGCTGGGCGAGG - Intronic
1002258893 5:177980943-177980965 GGTGGAAGCCAGACTGGGAAGGG + Intergenic
1004112973 6:12738570-12738592 AGCAGGAGCCAGGCTGGGCATGG + Intronic
1004275537 6:14232340-14232362 TTAGGCAGCCACACTGTGCAGGG + Intergenic
1006088170 6:31611779-31611801 TGGGGCAGGCAGAGTGGGCTTGG - Intergenic
1006184848 6:32175846-32175868 TGCCGCAGCCTGGCTGGGGAGGG - Intronic
1006921161 6:37628067-37628089 TGCTGCAGTCAGAGTGGGAAGGG - Intergenic
1007531593 6:42547735-42547757 TGCGGAGGCCAGCCTGGGCAAGG + Intergenic
1008365699 6:50677085-50677107 TGAGACGGCCAGGCTGGGCATGG - Intergenic
1008819024 6:55608947-55608969 TGCGTGAGCCACACAGGGCAGGG + Intergenic
1010137305 6:72570554-72570576 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1010679609 6:78783546-78783568 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1011397133 6:86921583-86921605 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1012285432 6:97382267-97382289 GGCGGCAGCCAGGCTGGGGGAGG - Intergenic
1012561472 6:100586296-100586318 GGCGGCAGCAAGGCTGGGGAAGG - Intronic
1013387413 6:109645486-109645508 GGCAGCAGCCAGGCTGGGCGAGG + Intronic
1015813608 6:137185681-137185703 GGCAGCAGCCAGACTGGTGAGGG - Intergenic
1017394311 6:153979337-153979359 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1017898803 6:158703360-158703382 CTCGCCAGCCAGACCGGGCAGGG + Intronic
1018708198 6:166478127-166478149 TGCGGCAGCTCGGCTGGGCGGGG + Intronic
1019210099 6:170397893-170397915 TCGGGCAGACTGACTGGGCAGGG + Intronic
1019709185 7:2510619-2510641 TTCGGCAGGCAGAGTGGGCCAGG + Intergenic
1020330361 7:7011512-7011534 GGCGGCAGCAAGACTGGGGGAGG - Intergenic
1021047414 7:15940645-15940667 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1021302599 7:18990636-18990658 GGCGGCAGCCAGGCTGGGGGAGG - Intronic
1021844427 7:24750324-24750346 TCCAGAAGGCAGACTGGGCATGG + Intronic
1021992728 7:26152931-26152953 GGCGGCAGCCAGGCTGTGCAGGG + Exonic
1023210902 7:37804010-37804032 TGCTGCCACCAGACTGGGCAAGG + Intronic
1024031849 7:45468202-45468224 TGCAGCAGCCAGCCTGGGGGAGG - Intergenic
1024059981 7:45690362-45690384 TGGGGCAGCCACAGTGGGAATGG + Intronic
1025703033 7:63837479-63837501 TTCGGCAGCTGGACTGGGGATGG - Intergenic
1025977986 7:66384698-66384720 TCAGGCAGCAATACTGGGCAGGG + Intronic
1026880650 7:73904840-73904862 AGTGGCAGCCAGCCTGGCCAGGG - Intergenic
1027639263 7:80713523-80713545 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1027819395 7:83024509-83024531 TGCAGCAGCCAGGCTGGGGGAGG + Intronic
1029059167 7:97779042-97779064 GGCGGCAGCGAGGCTGGGGAAGG - Intergenic
1029126770 7:98300134-98300156 TGTGGCTGCTGGACTGGGCAGGG + Intronic
1029416342 7:100445548-100445570 AGGGGCAGGCAGTCTGGGCATGG - Intergenic
1029492542 7:100880067-100880089 TGCAGGAGCCACACTGGCCAAGG + Intronic
1029990680 7:104960107-104960129 TGCGTCTTCCAGGCTGGGCACGG + Intergenic
1030592606 7:111500238-111500260 GGCGGCAGCGAGGCTGGGGAAGG + Intronic
1030725024 7:112916871-112916893 GGCGGCAGCGAGACTGGGGGAGG + Intronic
1031905055 7:127451365-127451387 GGCGGCAGCCTGGCTGGGGAAGG + Intergenic
1032083607 7:128872511-128872533 TGGGGCAGCCAGACTGGATTGGG - Intronic
1032388360 7:131539759-131539781 TGCAGCACCCAGACTGGGCACGG - Intronic
1033107088 7:138536923-138536945 GGCGGCAGCGAGGCTGGGGAAGG - Intronic
1034162757 7:149005068-149005090 TGCGGAATCCAGACAGGCCAGGG - Intronic
1038415686 8:27393599-27393621 TTCCGCAGCCTGGCTGGGCAGGG - Intronic
1039322674 8:36449902-36449924 TGCTGGAGCCAGGCTGGGAAAGG - Intergenic
1040608541 8:48959593-48959615 TGTGGCAGCCAGGCTGGGGGAGG - Intergenic
1041017958 8:53609922-53609944 GGCGGCAGCGAGACTGGGGGAGG + Intergenic
1041387478 8:57319535-57319557 GGCGGCAGCGAGGCTGGGGAAGG + Intergenic
1042087105 8:65121054-65121076 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1043176408 8:77027676-77027698 TGCAGCAGCCAGATTGAGCCAGG + Intergenic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1044209646 8:89535647-89535669 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1044746379 8:95375296-95375318 GGCGGCAGCCAGGCTGGGAGAGG - Intergenic
1045040275 8:98217101-98217123 TGCAGCAGACAGGCTGGGAAAGG + Intronic
1045064724 8:98435205-98435227 GGAGCCAGCCAGACAGGGCATGG + Intronic
1045088210 8:98710574-98710596 TGCGGCAGCGAGGCTGGGGGAGG + Intronic
1045450258 8:102317366-102317388 GGCGGCAGCCAGGCTGGGGGAGG + Intronic
1045453719 8:102354894-102354916 TGGGGCAGGCAGACTGTTCAAGG + Intronic
1046322236 8:112594421-112594443 GGCGGCAGCCAGGCTGGGGGAGG + Intronic
1046812603 8:118548955-118548977 GGCGGCAGCCAGGCTGGGGGAGG + Intronic
1048369141 8:133761730-133761752 TACGGTAGCCAGGCTGGGCGCGG - Intergenic
1048679498 8:136824037-136824059 TGGGGCAGCCAGAGTGCACAGGG + Intergenic
1049658022 8:143807371-143807393 TGGGGCAGCCCGTCTTGGCAGGG - Intronic
1050047123 9:1558850-1558872 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1051005097 9:12334418-12334440 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1051088403 9:13378822-13378844 TGCCACACCCAGGCTGGGCATGG + Intergenic
1051203912 9:14664412-14664434 GGCGGCAGCCAGGCTGGGGGAGG + Intronic
1051458749 9:17290597-17290619 GGCGGCAGCCAGGCTGGGGGAGG - Intronic
1051597986 9:18844751-18844773 TGCGGCAGCAAGGCTGGGGGAGG - Intronic
1051784629 9:20729008-20729030 TGAGGCAGCCAGACTGAGATTGG + Intronic
1052992921 9:34532273-34532295 TGCAGCAGCCAGGCTGGGGGAGG - Intergenic
1055333490 9:75208217-75208239 GGCGGCAGCCAGGCTGGGGGAGG - Intergenic
1055503677 9:76926857-76926879 AGTGGCAGCTAGACTGGGAAGGG - Intergenic
1055860815 9:80747254-80747276 GGCGGCAGCCAGGCTGGGGGAGG - Intergenic
1056948715 9:91024687-91024709 TGGGGCATCCAGGCAGGGCATGG + Intergenic
1058822340 9:108744289-108744311 ATCTGCAGCCACACTGGGCAGGG + Intergenic
1060225031 9:121785246-121785268 TGCGGGAGCCAGACTGTCCAGGG + Exonic
1060539469 9:124419892-124419914 GGCAGCAGCCATGCTGGGCAGGG - Intergenic
1060760245 9:126240943-126240965 TGCAGCTGCCAGGTTGGGCATGG + Intergenic
1061108939 9:128553008-128553030 TGCCGCAGCCGGATGGGGCAGGG - Intronic
1062549858 9:137080957-137080979 TGCGACAGCCATGCTGGGGAGGG + Intronic
1186968028 X:14809608-14809630 GGCGGCAGGCAGGCTGGGGAAGG + Intergenic
1187763131 X:22609601-22609623 GGCGGCAGCGAGGCTGGGGAAGG + Intergenic
1187848505 X:23566366-23566388 TGCGGCAGCGAGGCTGGGGGAGG - Intergenic
1188898784 X:35702512-35702534 TGAGTTAGCCAGACTGAGCAGGG + Intergenic
1189192684 X:39123980-39124002 TGGTGCAGCCAGTCTGGCCAGGG - Intergenic
1189597969 X:42590076-42590098 GGCGGCAGCGAGGCTGGGGAAGG + Intergenic
1190536443 X:51433160-51433182 GGCGGCAGCGAGGCTGGGGAAGG - Intergenic
1191020233 X:55851478-55851500 GGCGGCAGCGAGGCTGGGGAAGG - Intergenic
1191643345 X:63452068-63452090 GGCGGCAGCAAGACTGGGGGAGG - Intergenic
1191704930 X:64084567-64084589 GGCGGCAGCCAGGCTGGGGGAGG - Intergenic
1192941880 X:75921089-75921111 TGCTGCATTCAGACTGGGAAAGG + Intergenic
1193010990 X:76674819-76674841 GGCGGCAGCCAGACTGGGGGAGG + Intergenic
1193045238 X:77046644-77046666 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1195445751 X:104950559-104950581 GGCGGCAGCCAGGCTGGGGGAGG - Intronic
1195639345 X:107156183-107156205 GGCGGCAGCCAGGCTGGGGGAGG + Intronic
1195932851 X:110096395-110096417 GGCGGCAGCAAGGCTGGGGAAGG - Intronic
1197438381 X:126460361-126460383 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1197624119 X:128783071-128783093 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1197846226 X:130806037-130806059 TGCTTCTACCAGACTGGGCAAGG + Intronic
1198581826 X:138073828-138073850 GGCGGCAGCCAGGCTGGGGGAGG + Intergenic
1198643216 X:138778720-138778742 GGCGGCAGCCAGGCTGGGGGAGG + Intronic
1198738740 X:139817486-139817508 GGCAGGAGCCAGACTGTGCAGGG + Intronic
1199465304 X:148129052-148129074 GGCGGCAGCGAGACTGGGGGAGG - Intergenic
1199691588 X:150312963-150312985 TGTGGCAGCCAGACATGCCATGG + Intergenic
1200042608 X:153380816-153380838 TGGGGCCGCCAGTCTGTGCACGG - Intergenic
1200249467 X:154545075-154545097 TGGGGCAGTGAGACTGTGCAGGG - Intronic
1202014506 Y:20386270-20386292 GGCGGCAGCCAGGCTGGGGGAGG - Intergenic