ID: 1181054248

View in Genome Browser
Species Human (GRCh38)
Location 22:20252657-20252679
Sequence CTGTGTCATCCCTGGGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 1, 2: 4, 3: 46, 4: 280}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181054248_1181054258 0 Left 1181054248 22:20252657-20252679 CCTGAGCCCCAGGGATGACACAG 0: 1
1: 1
2: 4
3: 46
4: 280
Right 1181054258 22:20252680-20252702 CAGGGAGGGGCAGCCACTCTGGG 0: 1
1: 0
2: 8
3: 39
4: 437
1181054248_1181054260 18 Left 1181054248 22:20252657-20252679 CCTGAGCCCCAGGGATGACACAG 0: 1
1: 1
2: 4
3: 46
4: 280
Right 1181054260 22:20252698-20252720 CTGGGCTCCCCAGTCCCCCATGG 0: 1
1: 2
2: 4
3: 51
4: 464
1181054248_1181054257 -1 Left 1181054248 22:20252657-20252679 CCTGAGCCCCAGGGATGACACAG 0: 1
1: 1
2: 4
3: 46
4: 280
Right 1181054257 22:20252679-20252701 GCAGGGAGGGGCAGCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181054248 Original CRISPR CTGTGTCATCCCTGGGGCTC AGG (reversed) Intronic
900189430 1:1347064-1347086 CTGTGTCCTCCCTGGTCCTCTGG - Intronic
900386066 1:2411618-2411640 CAGCCTCATCCCTCGGGCTCAGG + Intronic
900497851 1:2984402-2984424 CTGTGCCATCTCTCAGGCTCTGG + Intergenic
900779088 1:4605867-4605889 CTCTCTCCTCCCTGTGGCTCTGG + Intergenic
901121311 1:6896337-6896359 CTGTGTCCTTCCTGGGGCAGTGG + Intronic
901490709 1:9595041-9595063 CTGTGGGAGCCCTGGGGCCCCGG - Intronic
901625673 1:10623574-10623596 CTGGGCCATCGCTGGGGCACTGG - Intronic
901628283 1:10635753-10635775 TTGTGACATCCCTGTGGCTGGGG + Intergenic
901776780 1:11565519-11565541 CTTTTTCATCTCTGGGTCTCAGG - Intergenic
902188033 1:14740185-14740207 CTTAGACATCCCTGGAGCTCAGG + Intronic
902618503 1:17636989-17637011 CTGTATCATCACTGGTGATCTGG + Intronic
903650817 1:24921064-24921086 CTGTGCCAGCCCTGGGGTACAGG - Intronic
904259694 1:29281276-29281298 CTGGGTCTTCCCTGAGGGTCTGG - Intronic
904280188 1:29413517-29413539 CTGTGTCCTCCCTTGAGCCCTGG + Intergenic
904478864 1:30782043-30782065 CTGGGACATCCCAGGGCCTCCGG - Intergenic
905540790 1:38758833-38758855 CTGTATAATCTCTGGGGATCAGG - Intergenic
905629493 1:39510850-39510872 CTGTCTCATCTCTGGGTCCCAGG + Intronic
905733953 1:40313811-40313833 CTGAGTCATGCCTGGGGCTGTGG + Intronic
907248655 1:53123511-53123533 CTGTGTTCTTCCTGGTGCTCTGG + Intronic
907557702 1:55359119-55359141 CTGTGGCATCCCTGGAGCTCTGG - Intergenic
909853898 1:80504477-80504499 CTGTTTCATCCCAGGAGCTGTGG + Intergenic
910727867 1:90357750-90357772 CTGTGTCAACCCTTTGGCTCTGG + Intergenic
915440017 1:155940138-155940160 CTGTGTCATCACTGTCTCTCGGG - Intergenic
916661280 1:166924288-166924310 CTGTGTGATCCCTGGGATACTGG - Intronic
916668781 1:166992379-166992401 CTGTGTCATTCCTGAGATTCAGG + Intronic
920094962 1:203480678-203480700 CTGATTCAGCCCTGGGGCTGAGG + Intronic
920248934 1:204609413-204609435 CCGTATCATCCATGGGTCTCTGG - Intergenic
920678827 1:208057640-208057662 CTGTCTCCTCCCTGTGTCTCTGG + Intronic
920969379 1:210730092-210730114 CTGTGTCATCACAGTTGCTCTGG - Intronic
922414530 1:225408478-225408500 CTGTGAAAGCCTTGGGGCTCAGG - Intronic
922514559 1:226197279-226197301 CTGGGGCAAACCTGGGGCTCTGG + Intergenic
923784634 1:237055219-237055241 CTGTGTCATCCTGGGGGGACTGG + Intronic
924735919 1:246755761-246755783 CTGTGTCCTCCCTTTGGTTCTGG + Intronic
924762857 1:247005630-247005652 CTCTGTCATCCCCTGGGCTCAGG - Intronic
1068386140 10:56330282-56330304 CTGAGTCACACCTGGGGCTGGGG + Intergenic
1069997681 10:72353126-72353148 GAGTGTCCTCTCTGGGGCTCAGG - Intronic
1070920278 10:80180379-80180401 CAGTGCCATGCCTGGGACTCTGG + Intronic
1071564042 10:86662478-86662500 CTCAGGCAGCCCTGGGGCTCTGG + Intronic
1075004992 10:118823708-118823730 CTGTGTCCTCCCTGGGAATTTGG - Intergenic
1075075508 10:119347823-119347845 CTGAGTCTTCCCTGGGGGGCAGG + Intronic
1075451292 10:122553409-122553431 CTGCTTCATCCCTGGAGCGCAGG + Intergenic
1076249469 10:128974002-128974024 CTGTGTCAGCCCTGGTGCTGGGG - Intergenic
1076756449 10:132575033-132575055 CGGAGTCCTCCCGGGGGCTCCGG + Intronic
1077186155 11:1236309-1236331 GTGGGGCATCCCTGGGTCTCAGG + Intronic
1077555410 11:3223723-3223745 CTGTGTTCTCCCTTGGGCTGCGG - Intergenic
1078089177 11:8253317-8253339 CTCTGTCCTCCCTGGGGTACTGG - Intronic
1078550553 11:12277278-12277300 CGTTGTCAAGCCTGGGGCTCAGG - Intronic
1079292463 11:19200595-19200617 TTGTGTCCTCCCTGGGGTTCAGG - Intronic
1080493910 11:32796885-32796907 CTGTGTAATCCCAGCTGCTCCGG + Intergenic
1081432023 11:42986695-42986717 CTGCTGCATGCCTGGGGCTCAGG + Intergenic
1081782987 11:45726400-45726422 CTGTGTGCTCCATGTGGCTCAGG + Intergenic
1083192593 11:61063023-61063045 CTATTTTCTCCCTGGGGCTCAGG + Intergenic
1084013896 11:66367641-66367663 CAGTGTCTTCTCTGGGGGTCAGG + Intronic
1085394584 11:76200901-76200923 CTGTGTCTTTCCCTGGGCTCCGG + Intronic
1086212966 11:84342961-84342983 TTGTGTCATCCCTGGTGCCTGGG - Intronic
1087641432 11:100759277-100759299 CTGTGTGTTTGCTGGGGCTCTGG + Intronic
1089603640 11:119629269-119629291 CTGCCTCATTCCTAGGGCTCTGG - Intronic
1090263638 11:125340578-125340600 TAGTGTCATGCCTGGGGCACAGG + Intronic
1090905210 11:131068737-131068759 CCATGTCATTCCTGGGGCTGGGG - Intergenic
1091018869 11:132080610-132080632 CTCTGTATTCCCTTGGGCTCTGG + Intronic
1091981007 12:4863972-4863994 TTGCTTCATCCCTGGGGCTCTGG - Intergenic
1092098982 12:5867509-5867531 CTGAGACTTCCCTAGGGCTCAGG + Intronic
1092192295 12:6529680-6529702 CTGTGGCATCCCTGGGACTGGGG + Intronic
1095095081 12:38143012-38143034 CTGTGTCCCCCCAGGGGCCCTGG + Intergenic
1097931764 12:65194969-65194991 CTTAGTCATTCCTGGGGCTTGGG - Intronic
1098258062 12:68637721-68637743 CTGTATCATCTTTGGAGCTCAGG - Intronic
1099810120 12:87569749-87569771 CACTGTCATCCCTGGGGCTAGGG - Intergenic
1100428232 12:94507372-94507394 CTGTGTCATACCTGGTTCTCGGG + Intergenic
1101318268 12:103649739-103649761 TAGTGGCATCCCTTGGGCTCAGG + Intronic
1101509863 12:105383243-105383265 CTGTGTTAGCGCTGGGGATCAGG - Intronic
1102224882 12:111221278-111221300 CTGTGTCCTCCTTGTGCCTCAGG + Intronic
1102641104 12:114367368-114367390 CTGTGTGAGCCCTGAAGCTCAGG - Intronic
1102744826 12:115241545-115241567 CTGTGCGAACCCTAGGGCTCTGG + Intergenic
1103199005 12:119071027-119071049 GTGTGTCCTCCCTAGGACTCAGG + Intronic
1103321221 12:120093775-120093797 CTTCTTCCTCCCTGGGGCTCGGG - Exonic
1103536820 12:121639000-121639022 GTGTGTCAGCCCTGGGGCTGGGG + Intronic
1103905859 12:124326916-124326938 CTGTCTCAGCCCTGGGAGTCAGG - Intronic
1104242122 12:127000244-127000266 CTGACTCTACCCTGGGGCTCTGG + Intergenic
1104343156 12:127970675-127970697 CTGCGTAAGGCCTGGGGCTCTGG - Intergenic
1104947903 12:132425105-132425127 CTTTGTCATCACTGGGGGACAGG + Intergenic
1105304665 13:19160184-19160206 CTGTGCCAGACCTGGGGCTTGGG + Intergenic
1106058330 13:26260443-26260465 CTCTGTTTTGCCTGGGGCTCTGG + Intronic
1107878861 13:44815661-44815683 CTGTGTCCCCCCTGGGGCCTGGG + Intergenic
1110068621 13:71143388-71143410 ATATGTCATCCCTGGGGGTGAGG + Intergenic
1110244048 13:73301589-73301611 CTCTGTCATCCCAGCGACTCAGG - Intergenic
1110689667 13:78417572-78417594 ATGGGTCATCCCTGGGGGACAGG - Intergenic
1112114311 13:96335489-96335511 CTTTCTCATCCCTGTGGCTCTGG + Intronic
1113647715 13:112010975-112010997 CTGTGCCAATCTTGGGGCTCTGG - Intergenic
1113944335 13:114035411-114035433 CAGTGTCACCCATGGGGCCCTGG + Intronic
1118385863 14:65255150-65255172 CTGAGTCATACATGGGGCCCAGG + Intergenic
1119789877 14:77340596-77340618 CTGTGTCACCCCTGAGGCTCAGG - Exonic
1120708720 14:87771459-87771481 CTGTGTCCCCCCAGGGGCCCTGG - Intergenic
1121004895 14:90483858-90483880 TTGCGTCATCCCTTGGGCTCTGG + Intergenic
1121435002 14:93913368-93913390 CTGTGTCCTCCCAAGGCCTCTGG + Intergenic
1121774677 14:96582850-96582872 CTGGGTCCTCCCTGGGACTCTGG + Intergenic
1122037916 14:98961876-98961898 CTGTGACCTCCCAGGGGCACAGG + Intergenic
1122657651 14:103273230-103273252 CTGTGTCACCGCTGGAGCCCAGG - Intergenic
1124002812 15:25772764-25772786 CGCTGTCTTCCCTGGGGTTCCGG - Intronic
1124423318 15:29541052-29541074 CTTTGTCATCGCTATGGCTCGGG + Intronic
1126178898 15:45765685-45765707 CTGTGTCAGGCCTGCAGCTCTGG + Intergenic
1127555428 15:60082803-60082825 CTGTGTCCTCTCTGGGACCCAGG - Intergenic
1128985388 15:72216855-72216877 CTGTGCCTTCCCAGGGGTTCTGG - Intronic
1129890533 15:79068913-79068935 CTGTGTGTTCCCTGGGGCCCAGG - Intronic
1130199866 15:81815064-81815086 CTGTTTCATCCAGGGTGCTCAGG + Intergenic
1130885300 15:88087670-88087692 TGGTGACATCTCTGGGGCTCTGG - Intronic
1132051234 15:98609419-98609441 CAGTGTGAACGCTGGGGCTCAGG - Intergenic
1132248822 15:100318152-100318174 CTGTTTCATTCCTTGGACTCAGG - Intronic
1135391977 16:22101278-22101300 CTGTGTCATCCAAGGGACTATGG - Intronic
1136068796 16:27775962-27775984 CTCTGTCCTCCCTGAGACTCAGG + Intronic
1136084558 16:27875497-27875519 CTCTGCCATTCCTGGGGCACCGG + Intronic
1136995575 16:35186406-35186428 CTGGGTCATCCATATGGCTCTGG + Intergenic
1137468086 16:48729510-48729532 CAGTCTCATCCCTGGAGCTGGGG + Intergenic
1138421114 16:56899784-56899806 CTGTCCCCTCCCTGGGGCTGAGG + Intronic
1139379610 16:66522199-66522221 CTGTGGCCTTCCTGGAGCTCAGG - Intronic
1140881932 16:79206271-79206293 CTATGTCTTCCACGGGGCTCCGG - Intronic
1141585878 16:85033306-85033328 CTGTGGCATCCCTGCTGCTGTGG - Intronic
1142255047 16:89009677-89009699 CTGGCTCATTCGTGGGGCTCAGG - Intergenic
1142671111 17:1487794-1487816 CTGTGTAATCCCAGCTGCTCGGG + Intronic
1142713722 17:1736888-1736910 CTGAGGGTTCCCTGGGGCTCTGG - Intronic
1142780254 17:2175975-2175997 CTGTGTCGCCCATGGGTCTCTGG - Intronic
1143150984 17:4807508-4807530 CTGGGTGTTCCCCGGGGCTCTGG + Intronic
1143407145 17:6685235-6685257 CTGTGTCCACTCTGGGCCTCAGG + Exonic
1144829565 17:18123704-18123726 ATGTGGCATCCCTGGGGGTCAGG + Intronic
1145041668 17:19581953-19581975 TGCTGTCATCCCTGGGGCTGTGG + Intergenic
1145961081 17:28886858-28886880 CAGTGCCAGCCCTGGGGCACTGG + Intronic
1146624435 17:34424817-34424839 CTGGGGCCTCCCTGGGTCTCAGG - Intergenic
1147234428 17:39046570-39046592 CTGAGTCATCCCTGAGGGCCAGG - Intergenic
1147723971 17:42554986-42555008 CTGTGTGGTCCCTGGGGATGGGG + Exonic
1148101793 17:45096770-45096792 CTGTGGCAACCCTGGAGCTCTGG - Intronic
1148475790 17:47927866-47927888 CTGTGTCCTCCCTGGGCCCCTGG + Exonic
1148777047 17:50101780-50101802 CCTTCTCATTCCTGGGGCTCTGG + Intronic
1151630760 17:75309339-75309361 CTGTGGCGTCCCTGGTGCTGTGG + Intergenic
1152202090 17:78953013-78953035 CTGTGCCTTCGCTGGGGCTCAGG - Intergenic
1152259764 17:79260609-79260631 CTGGGCCACCCCTGGGGCTCTGG - Intronic
1152749768 17:82057254-82057276 GTGTGCCCTCCCTGGGGCTGAGG + Exonic
1153238225 18:3008834-3008856 CTGTGTGATCCCAGCTGCTCAGG - Intronic
1153587321 18:6636019-6636041 CTGTTTCATCCCGAAGGCTCAGG - Intergenic
1155073740 18:22337810-22337832 CTGTTTCCTCCCTGAGGCTGGGG + Intergenic
1157203169 18:45676579-45676601 CTGTGTCATACCTGAGGCTGGGG + Intronic
1158412660 18:57221710-57221732 CTGTGCCAACCCTGGGGGTTTGG - Intergenic
1159246652 18:65814159-65814181 GTGTCTCATCCATTGGGCTCAGG - Intronic
1159672410 18:71237782-71237804 CTGTATCATCCCTGTGGTTAAGG + Intergenic
1160527741 18:79547454-79547476 CTGTGGCCTGCGTGGGGCTCCGG - Intergenic
1160742880 19:695419-695441 CTGCGTCTGCCATGGGGCTCGGG - Exonic
1160853365 19:1205472-1205494 CTGTGACCTCGGTGGGGCTCGGG - Intronic
1161037545 19:2093799-2093821 CTGTGTCGTCCCTGGGGAAAGGG + Intronic
1161238186 19:3208204-3208226 CAGTGCCAGCCCTGGGGTTCTGG + Exonic
1161325500 19:3661835-3661857 CTGGGTGAGCCCTGAGGCTCCGG + Intronic
1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG + Intergenic
1161621330 19:5298861-5298883 CTCTGTCCTTCCAGGGGCTCAGG + Intronic
1162910224 19:13844063-13844085 AAGTGTCATCCTTGGGGCTAGGG + Intergenic
1163365355 19:16873074-16873096 CTGTGTCCTCCCTGGGGCTCAGG + Intronic
1163432085 19:17274230-17274252 TTCTGTCATCCTTGGGGCCCAGG + Intronic
1163697969 19:18773534-18773556 CTGGGTCTGTCCTGGGGCTCGGG - Intronic
1165867167 19:38945963-38945985 TGGTCTCTTCCCTGGGGCTCTGG - Intronic
1165891629 19:39115969-39115991 CTGGGGGATCCATGGGGCTCTGG + Intergenic
1166396169 19:42442897-42442919 CTGAGTCATCCCCAGGGATCAGG - Exonic
1167880927 19:52456688-52456710 CTGCATCATCCCTGGTGCTGTGG + Intronic
1167893888 19:52565151-52565173 CTGTGTAATCCCAGCGACTCAGG + Intronic
1168076695 19:53984255-53984277 CTGTTTCACCCCTGGGGATCTGG - Exonic
1168270794 19:55248705-55248727 CTGTCTCTTCCCTGGGGCCTGGG - Intronic
925109150 2:1318908-1318930 CTCTGTCATCCCCGGGGCTCAGG + Intronic
925274361 2:2638324-2638346 CAGTGACATCCATGGGGCCCAGG - Intergenic
925413625 2:3654638-3654660 CTGTGTCATCCCAGAGCTTCTGG - Intergenic
925896795 2:8478365-8478387 ATGTGCCAACCCTGGGGCTTAGG - Intergenic
925988394 2:9234377-9234399 CTGTCGCATGGCTGGGGCTCTGG + Intronic
926108279 2:10166046-10166068 CTGGGTCGTCACAGGGGCTCTGG + Intronic
926170367 2:10549391-10549413 GTGTGTCCTCCCTGGGGTGCAGG + Intergenic
926271564 2:11370750-11370772 CCATGACAACCCTGGGGCTCAGG - Intergenic
926361902 2:12096560-12096582 CTGTCTCAGCTATGGGGCTCTGG - Intergenic
927193779 2:20534197-20534219 CTCTGGCACCCCAGGGGCTCAGG - Intergenic
927702634 2:25277506-25277528 CTGTGTCAGCCCTGCGGCTAGGG + Intronic
927808479 2:26168950-26168972 CTGGGTCAACACTGGGCCTCTGG + Intergenic
928373558 2:30758079-30758101 CTGTGGAACCCCTGGGGCTGGGG - Exonic
928928098 2:36598255-36598277 CTGTCCCAACCCTGGGTCTCCGG + Intronic
930229251 2:48827025-48827047 CTGTGTCAGCCTTTGGGCTTTGG + Intergenic
931978598 2:67670083-67670105 CTGTGTCATAACTGGGCCTAGGG + Intergenic
933935453 2:87199892-87199914 CAGTGAGATCCCTGTGGCTCAGG + Intergenic
934580333 2:95432770-95432792 CTGTGCACTCTCTGGGGCTCAGG - Intergenic
934599114 2:95643947-95643969 CTGTGCACTCTCTGGGGCTCAGG + Intergenic
935207418 2:100908415-100908437 CTGTGCAATCCCTGAGCCTCAGG - Intronic
936079779 2:109424175-109424197 CTGTCTGATCCTCGGGGCTCTGG + Intronic
936357695 2:111766007-111766029 CAGTGAGATCCCTGTGGCTCAGG - Intergenic
937295122 2:120805413-120805435 CTGTGTGCTCCCTGGGGCCTTGG + Intronic
937296934 2:120815081-120815103 CAGGCTCATCCCTGGGGCTCAGG - Intronic
937859609 2:126697501-126697523 CTAGGTACTCCCTGGGGCTCAGG + Intergenic
938176902 2:129142051-129142073 CTGTGTGGTGCCTGGGGCTGGGG + Intergenic
938238416 2:129724316-129724338 GGGTGGCATACCTGGGGCTCTGG + Intergenic
938293463 2:130162468-130162490 CTGTGCCAGACCTGGGGCTCAGG + Intronic
938463090 2:131510493-131510515 CTGTGCCAGACCTGGGGCTCAGG - Intergenic
939232615 2:139449379-139449401 CTGTGTGCTCCCTGGGGTACTGG + Intergenic
941885777 2:170525704-170525726 GTGTGTCATCCTTGCAGCTCTGG + Intronic
943276792 2:185877141-185877163 CTGTGAAATACCTGGTGCTCTGG - Intergenic
943428269 2:187763854-187763876 CTGTGTCATCTCTGTGCCTCTGG + Intergenic
947746868 2:232512375-232512397 GTGTGGCCTCCCTGGGGCTAGGG + Intergenic
1168997900 20:2146335-2146357 CTGCGTCTTCACTGGGTCTCAGG + Exonic
1169274061 20:4221377-4221399 CTGTGACATCCCTGAGGAACTGG - Exonic
1171116369 20:22528139-22528161 GTGTGTCATCCCTGGCTCTGTGG - Intergenic
1175448786 20:59044958-59044980 GTGTGTCATCCCTGGGGCAAGGG - Intergenic
1175799299 20:61792072-61792094 CTCTCTCCTCCCTGGGGCTCTGG - Intronic
1175868053 20:62191972-62191994 CTGTGCCAACCCTGTCGCTCCGG + Intronic
1175927067 20:62476097-62476119 CAGGGTCAGCGCTGGGGCTCCGG + Intergenic
1176215420 20:63945493-63945515 CTGTGGCATGCCTGGGGTTGGGG + Intronic
1176423348 21:6533203-6533225 CTGTCTCTTGCCTGGGTCTCAGG + Intergenic
1178425046 21:32472509-32472531 CTGTGTAATCCCTGCTACTCTGG + Intronic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1179520711 21:41942657-41942679 CTGTGTCCTCCCTGTTGCTAGGG + Intronic
1179698842 21:43141519-43141541 CTGTCTCTTGCCTGGGTCTCAGG + Intergenic
1180633114 22:17243619-17243641 CTGAGTCATCCCTGTGACTGAGG - Intergenic
1181054248 22:20252657-20252679 CTGTGTCATCCCTGGGGCTCAGG - Intronic
1181112825 22:20611900-20611922 CTGTGCCAGACCTAGGGCTCAGG + Intergenic
1181921001 22:26320422-26320444 CAGTGTCATCCCGGGGCCTTAGG + Intronic
1182015868 22:27039243-27039265 CTGAGCCACCCCTGGGGCTGAGG - Intergenic
1182149416 22:28017831-28017853 CTGTGTTAGCCCTGGGGATGGGG - Intronic
1182273397 22:29169988-29170010 TTGAGTCTTCCCTGAGGCTCAGG - Intergenic
1182273670 22:29171540-29171562 CAGCGTCACCCCTGGGCCTCTGG + Intergenic
1184598766 22:45530100-45530122 CAGTGGCATCCATGGGGCCCTGG - Intronic
1185079515 22:48701914-48701936 CTGCGTCATCCCGGGGACTGGGG + Intronic
1185176244 22:49328594-49328616 GTGTGTGGGCCCTGGGGCTCAGG + Intergenic
950040559 3:9916868-9916890 CTGTGTCCTCCTTAGGGCTCCGG + Intergenic
950097031 3:10336494-10336516 CTGTGTCCTCCCGGGGACCCTGG - Intronic
950528023 3:13536038-13536060 CTGAGTCTTCCATGGGGCTGCGG - Intergenic
953546901 3:43870276-43870298 CTGAGTCATCCCCTGAGCTCTGG + Intergenic
954652867 3:52175954-52175976 ATGAGTCATCCTTGGGTCTCAGG + Intergenic
955546750 3:60039325-60039347 CTGTTTCATACATGGGGCTTTGG + Intronic
961203493 3:125062649-125062671 CTGTGACATCTCTGGTGCTGTGG - Intergenic
961321809 3:126082270-126082292 TTGGCTCCTCCCTGGGGCTCTGG - Intronic
962118757 3:132540301-132540323 CTGGCTCCTCCCTGGGTCTCAGG - Intergenic
962350107 3:134650473-134650495 ATGAGTCAGCCCTGAGGCTCTGG + Intronic
962655043 3:137534928-137534950 GTGTGTCTTCTCTGTGGCTCAGG + Intergenic
963368645 3:144369384-144369406 CAGTGTTATGACTGGGGCTCTGG - Intergenic
968116830 3:196096897-196096919 CTGCGTCTTCCCAGGGGTTCAGG - Intergenic
968489602 4:882956-882978 CAGTGGCAGCCCTGGTGCTCAGG - Intronic
968592695 4:1466716-1466738 CTGTGGCCTCCCTGGGTCCCAGG - Intergenic
968659315 4:1792679-1792701 CTGTGTCCTCCTTGGGGGGCGGG + Intergenic
968816055 4:2822603-2822625 CTGTGGCCTCCCTGGGCCTCTGG + Intronic
968983851 4:3865040-3865062 CTGTGATCTCCCTGGAGCTCAGG - Intergenic
969369375 4:6721422-6721444 CTGTGTCATTCCTGAGACCCTGG + Intergenic
969528633 4:7717300-7717322 CTGGGGCATCCCTGGGGACCTGG - Intronic
969715134 4:8864684-8864706 CCCTGTTATCCGTGGGGCTCTGG - Intronic
969841399 4:9885435-9885457 CTGCCTCTTCCCTGGAGCTCAGG + Intronic
976193387 4:82510400-82510422 CTTTGTCCTCCCTGGGGCAATGG + Intronic
984288810 4:177766842-177766864 CAGTGGCTTCCCGGGGGCTCTGG - Intronic
985676702 5:1235140-1235162 CTGTGCCATCCTTGGGGGTCTGG + Intronic
985778213 5:1856540-1856562 TTGAGTCATGCCAGGGGCTCCGG - Intergenic
985793768 5:1947090-1947112 CTGCCTCCTCCCAGGGGCTCTGG + Intergenic
986004867 5:3659166-3659188 CCGTGGAGTCCCTGGGGCTCTGG + Intergenic
986343948 5:6817170-6817192 CTCTGTCACCCTTGGAGCTCAGG - Intergenic
991178425 5:63719135-63719157 CTGTATCATTCTTGGGACTCTGG + Intergenic
992003426 5:72456303-72456325 CTGTTTCATCAGTGGGGCTACGG - Intronic
993877698 5:93327444-93327466 GTGTGTCTTCCCTGGGGTTCAGG + Intergenic
994000175 5:94770287-94770309 GTGTGTCAGCCCTGGCTCTCGGG - Intronic
994293779 5:98064284-98064306 GGGTGTCCTCCCTGTGGCTCCGG - Intergenic
997248877 5:132373758-132373780 CTCAGTCATCCCTGGGGTACTGG + Intronic
1000192388 5:158924117-158924139 CTGGGTTCACCCTGGGGCTCAGG + Intronic
1001111443 5:168899851-168899873 CTGTGATGTCCCTGAGGCTCTGG + Intronic
1001406932 5:171483223-171483245 GTGCGTGATCACTGGGGCTCGGG + Intergenic
1002443490 5:179276088-179276110 CTGACTCATCCCTGGGTCTCAGG + Intronic
1002871075 6:1167715-1167737 CCGGGTCATCCCTTGGGCCCTGG - Intergenic
1003357313 6:5385880-5385902 CTGGCTTATCCCTGGGGCTCAGG + Intronic
1003408731 6:5844812-5844834 CTCTGCCATCCCTGGTGTTCTGG + Intergenic
1004069878 6:12288462-12288484 CTGTGGCCTCCCTGGGCCCCGGG + Intergenic
1004288660 6:14346548-14346570 CTGTGCCCTGCCTGGGGCTGAGG - Intergenic
1005809908 6:29507492-29507514 CTGTGGCAGCCATGGGGCTTAGG - Intergenic
1006944657 6:37777474-37777496 CTGACTCCTCCCTGGGGCCCAGG - Intergenic
1007145738 6:39628445-39628467 CTGTGTCTTCACTGTGGCTCTGG - Intronic
1008085444 6:47239421-47239443 CTCTGCCATCCCCGGGGCTAGGG - Intronic
1010836734 6:80597643-80597665 CTGTTTCATCCCTGGGATGCAGG - Intergenic
1015465309 6:133542611-133542633 CTGTGTCAGCCAGGGTGCTCAGG + Intergenic
1016712671 6:147191709-147191731 CTGTGGCATCCCTGAGGCAGAGG - Intergenic
1016824217 6:148373491-148373513 CTGTGTCATCCTGGGGGCTGTGG + Intronic
1017751632 6:157494208-157494230 TAGTGACATCCCAGGGGCTCTGG - Intronic
1018238507 6:161749710-161749732 CTCTGTAATCCCTCGGCCTCGGG + Intronic
1018685007 6:166297649-166297671 CTGTGTCATCCCAGGGTCTGCGG - Intergenic
1018817310 6:167343197-167343219 CTGACACAGCCCTGGGGCTCGGG - Intronic
1019420626 7:949123-949145 CTGTGCAGTCACTGGGGCTCAGG - Intronic
1019636119 7:2076675-2076697 CTGTGTCATACCTGTGTCTCGGG - Intronic
1019815246 7:3195211-3195233 GTGTGTCAGGCCTGGGGCTGGGG + Intergenic
1020117982 7:5487096-5487118 CAGTGTCAGCCCTGCAGCTCTGG - Intronic
1020275858 7:6623963-6623985 CTGTGCCATTGCTGGGGCTGGGG + Exonic
1024562948 7:50660021-50660043 CTTTATCCTCCCTGGGCCTCAGG + Intronic
1024803706 7:53111177-53111199 CTCTGTCATCCCTGTGGATTTGG - Intergenic
1026957891 7:74389281-74389303 CTGGGTCCTCCCTGTGGCCCTGG + Intronic
1034253000 7:149707026-149707048 CTGGCTGATCCCTGGGGCTGGGG + Intergenic
1034949043 7:155284699-155284721 CCGTGTCATCCCTGGGAACCTGG + Intergenic
1035169415 7:157009483-157009505 CCGTCTCATGCCTGGGGGTCCGG + Intronic
1035286727 7:157811570-157811592 CTGTGTGATGCCTGGTGCTGAGG - Intronic
1035830412 8:2688841-2688863 CTGTGTTATCCAGGGAGCTCTGG - Intergenic
1036242075 8:7089865-7089887 CTGTGTATTCCCTTGGGCGCAGG + Intergenic
1038035423 8:23682690-23682712 CTGCGTCCTCCCTCTGGCTCTGG + Exonic
1043992649 8:86774980-86775002 ATGTGTCAGCCCTGTGTCTCAGG - Intergenic
1045993481 8:108337145-108337167 CTGTGTATTCACTGTGGCTCTGG + Intronic
1046158087 8:110320314-110320336 CTGTTACATCCCTTGGTCTCGGG + Intergenic
1046587673 8:116167741-116167763 CTGTCTCTTCCCTGGGGGTCAGG - Intergenic
1047577432 8:126172664-126172686 ATGTGTTAACCCTGTGGCTCAGG - Intergenic
1049036106 8:140077513-140077535 CTGCCTCAGCCCTGGGGCTCAGG - Intronic
1049259126 8:141629433-141629455 CTGTGCCCTCTCTGGGCCTCAGG + Intergenic
1049274360 8:141712248-141712270 CTGAGTCACCCCTGGGAATCAGG + Intergenic
1049367085 8:142245297-142245319 AAGTGTGATCCCTGGGTCTCAGG - Intronic
1049411791 8:142476895-142476917 CTGTGCCATCCCTGGGCCTCTGG - Intronic
1049579343 8:143404366-143404388 CTGTGCAATCCTTGGTGCTCCGG + Intergenic
1053062373 9:35042444-35042466 CAGCTTCATCCCTGGTGCTCTGG + Exonic
1055029269 9:71756591-71756613 CTTTGACATCCTTGAGGCTCTGG + Intronic
1056103842 9:83327464-83327486 CAGTGTCATCCCTGGCTCTCTGG + Intronic
1056317590 9:85406157-85406179 CTGTGCAATGCATGGGGCTCTGG + Intergenic
1057724919 9:97561667-97561689 CTGTGTCATCACTGGTGTCCTGG + Intronic
1058900740 9:109440087-109440109 GTGTGTCATGCCTGGTGCTGGGG - Intronic
1059218084 9:112585513-112585535 CAGTGTCCTCCACGGGGCTCAGG + Intronic
1059327261 9:113511664-113511686 CTGTGACAGCCCTGGGCCCCTGG + Intronic
1059404821 9:114093136-114093158 CCCTGGAATCCCTGGGGCTCTGG + Intronic
1059425693 9:114219702-114219724 TTGTGTCCCCCCTGGGGGTCTGG + Intronic
1060991867 9:127854164-127854186 CAGAGCCATCCTTGGGGCTCTGG - Intronic
1061425082 9:130493609-130493631 CTGGGTCAGCCCAGGGGCTGCGG - Intronic
1061878563 9:133557084-133557106 GTGGGTCTTCCTTGGGGCTCAGG + Intronic
1062233671 9:135497750-135497772 CTGAGTTTTCCCTGGGGATCAGG - Intronic
1062247421 9:135576304-135576326 CTGTGGCGTCTCTGGGGCACAGG - Intergenic
1062525046 9:136974811-136974833 CTGTCTCCACCCTGGGGCCCCGG - Intergenic
1186115100 X:6297105-6297127 CTGTGTCATGGCTGGAACTCAGG - Intergenic
1186378556 X:9033632-9033654 CTGGGTGATCCCTAGGGCCCGGG - Intronic
1186429917 X:9496438-9496460 CTGTGTCAGCCCTGGGGGAGAGG - Intronic
1187247680 X:17567608-17567630 CTGTTCTTTCCCTGGGGCTCAGG - Intronic
1191654061 X:63576914-63576936 CTGAGTCATCCCTGGGCAACAGG - Intergenic
1191858271 X:65645060-65645082 CTGAGTCATCCCTGGGCTACTGG + Intronic
1192215089 X:69152610-69152632 CTGTTTGATGCCTGAGGCTCAGG - Intergenic
1193090678 X:77490944-77490966 CTGAGACATCCCTGAGGTTCTGG + Intergenic
1194401225 X:93439877-93439899 CTGTGTCCTGCCTGGGGCTGGGG + Intergenic
1195544762 X:106101821-106101843 CTCTTTCATCCCTGGAGTTCAGG + Intergenic
1197610255 X:128630523-128630545 CTTTGTCATGCCTGGGGAACTGG + Intergenic
1200080996 X:153576281-153576303 CTATGTCCTGCCTGGGGCCCTGG - Intronic
1201481837 Y:14447853-14447875 CTGTGTCATGGCTGGAACTCAGG + Intergenic
1201774178 Y:17646022-17646044 CTGTGTCCTCTGTGGGGCTCTGG + Intergenic
1201827379 Y:18259967-18259989 CTGTGTCCTCTGTGGGGCTCTGG - Intergenic