ID: 1181057120

View in Genome Browser
Species Human (GRCh38)
Location 22:20265511-20265533
Sequence CAGTCCCAGCAGAAGGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181057115_1181057120 12 Left 1181057115 22:20265476-20265498 CCTGCTTCTCACTCCATGCAAAC 0: 2
1: 0
2: 1
3: 18
4: 209
Right 1181057120 22:20265511-20265533 CAGTCCCAGCAGAAGGACCCTGG No data
1181057117_1181057120 -10 Left 1181057117 22:20265498-20265520 CCTACGTTTCTGCCAGTCCCAGC 0: 1
1: 1
2: 1
3: 8
4: 154
Right 1181057120 22:20265511-20265533 CAGTCCCAGCAGAAGGACCCTGG No data
1181057108_1181057120 30 Left 1181057108 22:20265458-20265480 CCCTCCCTCAGCCTCTCCCCTGC No data
Right 1181057120 22:20265511-20265533 CAGTCCCAGCAGAAGGACCCTGG No data
1181057114_1181057120 13 Left 1181057114 22:20265475-20265497 CCCTGCTTCTCACTCCATGCAAA 0: 2
1: 0
2: 2
3: 23
4: 289
Right 1181057120 22:20265511-20265533 CAGTCCCAGCAGAAGGACCCTGG No data
1181057109_1181057120 29 Left 1181057109 22:20265459-20265481 CCTCCCTCAGCCTCTCCCCTGCT 0: 1
1: 1
2: 18
3: 273
4: 1704
Right 1181057120 22:20265511-20265533 CAGTCCCAGCAGAAGGACCCTGG No data
1181057110_1181057120 26 Left 1181057110 22:20265462-20265484 CCCTCAGCCTCTCCCCTGCTTCT 0: 1
1: 1
2: 5
3: 105
4: 866
Right 1181057120 22:20265511-20265533 CAGTCCCAGCAGAAGGACCCTGG No data
1181057111_1181057120 25 Left 1181057111 22:20265463-20265485 CCTCAGCCTCTCCCCTGCTTCTC 0: 1
1: 2
2: 20
3: 147
4: 1152
Right 1181057120 22:20265511-20265533 CAGTCCCAGCAGAAGGACCCTGG No data
1181057116_1181057120 -1 Left 1181057116 22:20265489-20265511 CCATGCAAACCTACGTTTCTGCC 0: 2
1: 0
2: 0
3: 8
4: 97
Right 1181057120 22:20265511-20265533 CAGTCCCAGCAGAAGGACCCTGG No data
1181057112_1181057120 19 Left 1181057112 22:20265469-20265491 CCTCTCCCCTGCTTCTCACTCCA 0: 2
1: 0
2: 6
3: 120
4: 1149
Right 1181057120 22:20265511-20265533 CAGTCCCAGCAGAAGGACCCTGG No data
1181057113_1181057120 14 Left 1181057113 22:20265474-20265496 CCCCTGCTTCTCACTCCATGCAA 0: 2
1: 1
2: 1
3: 31
4: 363
Right 1181057120 22:20265511-20265533 CAGTCCCAGCAGAAGGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181057120 Original CRISPR CAGTCCCAGCAGAAGGACCC TGG Intronic
No off target data available for this crispr