ID: 1181057932

View in Genome Browser
Species Human (GRCh38)
Location 22:20268557-20268579
Sequence CAGAGGCCATTCCTAGGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181057932_1181057935 -2 Left 1181057932 22:20268557-20268579 CCGAGGCCTAGGAATGGCCTCTG 0: 1
1: 0
2: 1
3: 25
4: 201
Right 1181057935 22:20268578-20268600 TGCCTGACCCACTCCCTTCCTGG 0: 1
1: 0
2: 2
3: 50
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181057932 Original CRISPR CAGAGGCCATTCCTAGGCCT CGG (reversed) Intronic
900568667 1:3347719-3347741 CAAACACCATGCCTAGGCCTTGG + Intronic
900569420 1:3351068-3351090 CAGCGGCCATTCCCAGGACACGG - Intronic
901017062 1:6237982-6238004 CAGACGCCAGAGCTAGGCCTTGG + Intergenic
901129239 1:6951800-6951822 CAGAGGCCTTTCCCAGGCTGGGG - Intronic
901883936 1:12209621-12209643 CAGAGGACATCCCTGGGCCCAGG + Intergenic
902685276 1:18072646-18072668 CAGAGGCCAGTCCTGAGTCTAGG + Intergenic
904282055 1:29427524-29427546 CTGGGGCCTTTCCAAGGCCTTGG + Intergenic
904385601 1:30140197-30140219 CAGAGTCCATTCTAAGGCCCTGG - Intergenic
904445894 1:30572684-30572706 CAGAGGCCATACCCAGGGCTGGG + Intergenic
905309992 1:37042572-37042594 CAGAGGCAGCTCCGAGGCCTGGG + Intergenic
906837821 1:49102926-49102948 CTGAGGCCCATTCTAGGCCTAGG + Intronic
915913138 1:159926410-159926432 CAAAGGCTATTCCTCTGCCTAGG + Intergenic
920364170 1:205439428-205439450 CAGGGGCCTTTCCTGGGCTTTGG - Intronic
922118236 1:222635313-222635335 CAGAGCCCTCTTCTAGGCCTGGG + Intronic
922734170 1:227970713-227970735 GAGAGGCCGTTGCTGGGCCTGGG - Intergenic
1065060943 10:21899856-21899878 CAGAGGCCACCCCTCTGCCTAGG + Intronic
1066962359 10:42234533-42234555 CAGGGGCAATTCCAAGGCCAAGG + Intergenic
1069747095 10:70722439-70722461 CAGAGGACAAGCCCAGGCCTTGG - Intronic
1071452458 10:85810316-85810338 CAAGGGCCATTCCTGGGCCCAGG - Intronic
1073423439 10:103442082-103442104 CAGCGGCCAGTCCCAGGCCAGGG + Intronic
1073492567 10:103863697-103863719 CAGAGGCCCATCCTAGGCCGAGG + Intergenic
1073529707 10:104219844-104219866 CACATGCCATTCCTCTGCCTAGG + Intronic
1075204187 10:120432435-120432457 TAGAGGCCATTCCTAAGCAAGGG - Intergenic
1075648554 10:124112394-124112416 CAGAGGCCAGCCCTGGGACTGGG + Intergenic
1076725012 10:132409186-132409208 CACAGGCCATTCACAGGCCCTGG - Intronic
1077481057 11:2814831-2814853 CAGAGTCAAGACCTAGGCCTTGG - Intronic
1077518825 11:3019045-3019067 GAGAGGCCCTTCTGAGGCCTGGG + Intronic
1078226530 11:9396583-9396605 CCGACCCCATTCCTAGCCCTAGG + Intronic
1078869465 11:15329980-15330002 CAGAGGCCCTTCCTTGGACCAGG - Intergenic
1080607689 11:33877234-33877256 CAGAAGCCATTCCTGGCCATTGG + Intronic
1083628228 11:64082741-64082763 CAGAGGGGATTCCTGGGCCTTGG + Intronic
1083699722 11:64467959-64467981 CAGATGCCAATCCCAGTCCTGGG - Intergenic
1083887922 11:65581694-65581716 CTGAGGGCATGCCTGGGCCTGGG - Exonic
1085210241 11:74770219-74770241 GAGAGCCCATTCCTGGGCCTTGG + Intronic
1088486871 11:110349064-110349086 GAGAGTTCATTCCAAGGCCTAGG + Intergenic
1091918252 12:4284458-4284480 CAGAGGCCGTCCCAGGGCCTAGG - Intronic
1099917101 12:88908204-88908226 TAGAGGCCATTTCTAGTCCACGG + Intergenic
1101469819 12:104986172-104986194 CAGGGGCCATTCCTACTCCTGGG - Intergenic
1102924299 12:116815155-116815177 CAGAGGCCACTCCCAGGCCTGGG + Intronic
1106409373 13:29500270-29500292 CAGAGGCCAGTCCTGTGGCTAGG + Intronic
1107729645 13:43335527-43335549 TAGAGTCCAGTCCTAGACCTGGG + Intronic
1108595538 13:51945569-51945591 CAGGGGCCAATCCTAGACTTGGG - Intronic
1112291200 13:98144611-98144633 CAGAAGCCAGTGCTAGGCCAGGG - Intronic
1113916292 13:113875974-113875996 CTGAGGCCAGTCCTCAGCCTGGG + Intergenic
1116206101 14:41868696-41868718 TAGAGGCCATTACTAGTCTTAGG + Intronic
1117409819 14:55440536-55440558 CAGAGGCCATTTATGAGCCTGGG + Exonic
1119278199 14:73379862-73379884 CAGAGGCCATTCCAAGTACTTGG + Intronic
1121423514 14:93832292-93832314 CAGAGCCCAACCCAAGGCCTAGG - Intergenic
1121714009 14:96059906-96059928 CAGACCCCATCTCTAGGCCTGGG + Intronic
1122186225 14:99998880-99998902 CAGAGACCATTACTGGACCTTGG - Intronic
1122265595 14:100545256-100545278 TAGAAGCCTTTCCTAGGCCAGGG + Intronic
1122460843 14:101893441-101893463 CATAGGCCATTCATTGGCCATGG - Intronic
1125281918 15:38051006-38051028 CAGAGCCCCTTCCAGGGCCTTGG - Intergenic
1128788369 15:70414909-70414931 CAGTGGCCCTTCCTGGGACTGGG - Intergenic
1129866037 15:78909560-78909582 CTGAGACCATTCCTAGGCCCAGG - Intergenic
1130015225 15:80180903-80180925 CAGAGACCCTGCCTCGGCCTTGG - Intronic
1131520773 15:93112879-93112901 CAGGGCCCTTTCCAAGGCCTGGG + Intergenic
1131734401 15:95316747-95316769 CAGATGCCATTCCATGGCCCAGG + Intergenic
1132122441 15:99188995-99189017 CAGAGAAAATTCCTAGGCATGGG - Intronic
1132211503 15:100026685-100026707 CAGAAGCCATGCCTGTGCCTCGG - Intronic
1133272141 16:4615393-4615415 CAGACACCGTTCCTGGGCCTTGG - Intergenic
1136040250 16:27572881-27572903 CAGCGGTTCTTCCTAGGCCTTGG + Intronic
1137003479 16:35251448-35251470 CAGAGGCTCTTCCCAGGACTGGG + Intergenic
1138426732 16:56939250-56939272 CAGCAGGCATTCCAAGGCCTGGG + Exonic
1139597389 16:67966437-67966459 CACAGGCAGTCCCTAGGCCTAGG - Intronic
1139692673 16:68651065-68651087 CAGGGGCCTTCCCTGGGCCTGGG + Intronic
1140262765 16:73395059-73395081 CAGTGGCCATGCCTGGGGCTAGG + Intergenic
1141557362 16:84845037-84845059 CAGATGCTATTCCTAGGCCAGGG - Intronic
1141841301 16:86575957-86575979 CAGAGGCCCCTCCTAGGCTCAGG + Intergenic
1143025969 17:3942164-3942186 TAGAGGCTGTTCCTAGGCCCGGG - Intronic
1143250946 17:5522597-5522619 AAGAGGGCATTTCTAGGCCTGGG + Intronic
1144745109 17:17608937-17608959 TAGAGGGCATTCCCGGGCCTAGG + Intergenic
1144914479 17:18712017-18712039 CAGACTCCATTCCCAGGCCCAGG - Intronic
1145275503 17:21426983-21427005 CAGAGCCCAGTCCCAGGCCTGGG + Intergenic
1145313355 17:21712877-21712899 CAGAGCCCAGTCCCAGGCCTGGG + Intergenic
1145711802 17:26984833-26984855 CAGAGCCCAGTCCCAGGCCTGGG + Intergenic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1148805327 17:50261004-50261026 CAGAGGCCGTAGCAAGGCCTGGG - Intergenic
1148997283 17:51722011-51722033 CAGAGGCCAATCATAAGTCTAGG - Intronic
1149686744 17:58540025-58540047 TAGAGGCCATTGCTAGGCTTTGG + Intronic
1150765542 17:67998928-67998950 CAGAGTCCAGTCCTGGGTCTTGG + Intergenic
1153711213 18:7801357-7801379 CAGTGACCAATTCTAGGCCTAGG - Intronic
1153793047 18:8597044-8597066 CAGAAGCCCCTCCAAGGCCTGGG + Intergenic
1157592295 18:48843096-48843118 CAGGGGCCAGTCCTGGGGCTTGG - Intronic
1157804002 18:50644550-50644572 CAGAGGCCATTTCCAGGGCTTGG - Intronic
1158025067 18:52886212-52886234 CCTAGGCAATTCCTAGTCCTGGG - Intronic
1158163923 18:54517671-54517693 CAGAGGCCTTTCTGGGGCCTGGG + Intergenic
1160440166 18:78883631-78883653 CAAAGGCTATCCCTTGGCCTGGG - Intergenic
1162865566 19:13543564-13543586 CAGAGGCCCTTCCTAGACAATGG + Intronic
1164874720 19:31675797-31675819 CAGAGGCCATTCCCAGGGTTTGG + Intergenic
1165114141 19:33518882-33518904 CAGAAGCCTTTCCCAGCCCTCGG - Intronic
1165147575 19:33741231-33741253 CAGAGGCCAGTCCTTGGTCAGGG - Intronic
1166956510 19:46468932-46468954 TGGAGGCCAATCCCAGGCCTTGG + Intronic
1167610642 19:50506345-50506367 CAGAGGCGATTCCAAGACCAGGG - Intronic
925387424 2:3471961-3471983 CTGTGGCCAGTCCTAGGCCTCGG + Intronic
925584012 2:5444476-5444498 CAGATGCCCTTCCTGCGCCTTGG - Intergenic
926608098 2:14917720-14917742 AAGAGGCCATTCCTTGTCCAGGG - Intergenic
927502224 2:23590546-23590568 CAGACGCCATGCCGAGGCCCTGG + Intronic
928437136 2:31261886-31261908 CAGGGGCCATGTCTGGGCCTGGG + Intronic
930993150 2:57685003-57685025 CAGAGGCCAGTCCTGGCACTTGG - Intergenic
932498177 2:72157956-72157978 CAGAGGCTATACCTAGCCCAGGG - Intergenic
932856765 2:75241791-75241813 CCGGGTCCATTTCTAGGCCTTGG - Intergenic
933644570 2:84799799-84799821 TTAAGTCCATTCCTAGGCCTTGG - Intronic
934686750 2:96326924-96326946 CAGAGGCCCTTCCTGGCCATCGG - Exonic
935008418 2:99106086-99106108 CATATGCCATTCCTATGTCTTGG + Intronic
935176474 2:100653572-100653594 CAGAGGGCATGCCTGGGCCAAGG + Intergenic
935636375 2:105252365-105252387 CAGAGAGAATTCCAAGGCCTTGG - Intergenic
936077461 2:109410769-109410791 CAGAGCCCTTTCCTGGGCATGGG + Intronic
936525590 2:113239462-113239484 CAGAGGGCATTCCTATGCCCAGG + Intronic
944494350 2:200291251-200291273 CTGAAGCCATTCTTAGGCCAGGG - Intergenic
945809751 2:214534266-214534288 CTTAGGCCATCACTAGGCCTGGG + Intronic
947825683 2:233104809-233104831 CAGAAGCAGATCCTAGGCCTTGG + Intronic
948045412 2:234940051-234940073 CAGAGACAATTGCCAGGCCTGGG + Intergenic
1168862889 20:1058738-1058760 CTGTAGCCATCCCTAGGCCTTGG + Intergenic
1170043176 20:12059701-12059723 CAGTGGCTATTCCTGGGTCTTGG + Intergenic
1170608852 20:17895287-17895309 CTGAGGGCATTCCTCGACCTGGG - Intergenic
1171094312 20:22316755-22316777 CAGAGGTCTCTCCCAGGCCTGGG - Intergenic
1172029788 20:31973774-31973796 CAGAGGCCATGGCAAGGACTAGG + Intronic
1173862470 20:46293196-46293218 AACAGGCCATTGCTAGGACTGGG - Intronic
1175597773 20:60249104-60249126 CACAGGCCATCCCCTGGCCTTGG + Intergenic
1175741711 20:61424607-61424629 TAGAGGCCACTCCTAGGCCAGGG + Intronic
1177773245 21:25539927-25539949 CCCAGGCCTTTCCTGGGCCTGGG - Intergenic
1178808404 21:35858978-35859000 CACAGGCCATTACTAGCACTGGG - Intronic
1178883268 21:36465123-36465145 CAGAGGCCATTCGGAGATCTGGG - Intronic
1180727870 22:17959967-17959989 CAGAGTGCACTCCTAGGCATTGG - Intronic
1181000963 22:19987487-19987509 CCGAGGCCAAACCGAGGCCTGGG - Intronic
1181057932 22:20268557-20268579 CAGAGGCCATTCCTAGGCCTCGG - Intronic
1181125125 22:20697678-20697700 CAGAGGCCAGGCCTGGCCCTGGG - Intergenic
1183432652 22:37774979-37775001 CAGAGGTCATGCCCAGCCCTGGG + Exonic
1185297444 22:50061302-50061324 CGGGGGCCCTTCCTCGGCCTGGG + Exonic
950831608 3:15880018-15880040 CAGAGACCACTCCTTGGTCTAGG - Intergenic
951481233 3:23164583-23164605 CAGCTGCCATCCCTAGGACTGGG + Intergenic
953610888 3:44446325-44446347 CAGAGGCCACTCCTAGGGGCCGG + Exonic
954284006 3:49604935-49604957 GAGAGGCCATGCCAAGGCCCTGG - Intronic
957140220 3:76345251-76345273 CAGAGGCCTTTCCCATGACTTGG - Intronic
958169345 3:89918386-89918408 AAGAGGCCACTCCCTGGCCTGGG + Intergenic
960705581 3:120477746-120477768 CAGCCACCATTCCTAGGGCTAGG + Intergenic
961042632 3:123688167-123688189 CAGAGGCCATTCACTGCCCTGGG - Intronic
961084505 3:124055192-124055214 CAGAGGGCATGCATAGGACTTGG + Intergenic
963129273 3:141843183-141843205 TAGAGACCATTCCAAAGCCTGGG - Intergenic
963331399 3:143920028-143920050 CAGAGGCAAGGCCTGGGCCTGGG + Intergenic
964539989 3:157769239-157769261 CAGAGGCAATGCCAGGGCCTTGG - Intergenic
968066940 3:195764009-195764031 CAGAGGCTCTTCCTGGGCCTGGG + Intronic
969341140 4:6542255-6542277 CAGAAGCCAGTCCTATGCCTAGG + Intronic
969613724 4:8240623-8240645 CAGAGGCCGTTCCTGTGCCCAGG - Intronic
972560273 4:40221182-40221204 CAGAGACCTTTCCTCTGCCTGGG + Intronic
979887450 4:126046786-126046808 CAGAGGGCATATCCAGGCCTGGG - Intergenic
983021079 4:162675871-162675893 CCAATTCCATTCCTAGGCCTTGG - Intergenic
985969220 5:3362103-3362125 CAGAGGCCGCTCCTGGCCCTGGG + Intergenic
986430750 5:7678975-7678997 CAGAGGCCATTGCCTGGCATAGG - Intronic
986523783 5:8650250-8650272 CAGGGGCCATTCCCAGGCAGAGG - Intergenic
986757539 5:10852195-10852217 GACAGACAATTCCTAGGCCTGGG - Intergenic
987529482 5:19099007-19099029 CAGAATCCATTTCTAAGCCTTGG - Intergenic
987542368 5:19271763-19271785 CAGAGGCCACTCCCATTCCTTGG - Intergenic
989445621 5:41525082-41525104 AAAAGGCCATTCTTAGGCATGGG + Intergenic
992754620 5:79892607-79892629 CAGAGGCCACTCATATTCCTTGG - Intergenic
993669122 5:90739639-90739661 CAGAGGCAATTACTACGCCCAGG - Intronic
997065049 5:130549681-130549703 CAGAGTCCATTCCTTGGGTTTGG - Intergenic
999325022 5:150638604-150638626 CAGAGACCAGTCCTGGCCCTAGG + Intronic
1001961887 5:175884501-175884523 CACAGGCACTTCCCAGGCCTTGG + Intergenic
1002089312 5:176795080-176795102 GACAGGCCGGTCCTAGGCCTCGG + Intergenic
1002570246 5:180136049-180136071 CAGAGCCCTGTCCTGGGCCTTGG - Intronic
1003232725 6:4269255-4269277 CAGATGTGATTCCTCGGCCTTGG + Intergenic
1003500168 6:6696607-6696629 GAGAGGCCAATCCTAGGGCTTGG + Intergenic
1005502509 6:26442149-26442171 CAGAGGCCATTCCCAGACTCAGG + Intronic
1005973295 6:30778322-30778344 CAGAGGCCAGCACTAGGTCTTGG - Intergenic
1006339601 6:33439497-33439519 CTGAGGTCATTGGTAGGCCTTGG + Intronic
1007637374 6:43307626-43307648 GGGAGGCCAGTCCTTGGCCTGGG + Exonic
1008276621 6:49550707-49550729 CAGAGGCCACACCCAGGGCTTGG + Exonic
1015256664 6:131185285-131185307 CAGAGGCCAATCCTAGAACCTGG + Intronic
1017477126 6:154808348-154808370 TAGGGGCCATGCTTAGGCCTTGG - Intronic
1019303035 7:318556-318578 CAGTGGCCATTCACAGGCTTGGG + Intergenic
1021762935 7:23919003-23919025 CAGAGCACATTCCTTAGCCTTGG - Intergenic
1021767945 7:23968208-23968230 CAGAGGCCATTTCAAGCCATGGG - Intergenic
1022211909 7:28219068-28219090 CTGAGGCCATTGCTAGACCAGGG - Intergenic
1022509248 7:30924723-30924745 CAGATGCCCTTGCTGGGCCTGGG + Exonic
1022545719 7:31187113-31187135 CACATGCCATTCCTACTCCTGGG + Intergenic
1023553314 7:41391997-41392019 CAGAGGCCTTTCCTCTGGCTGGG + Intergenic
1024037767 7:45523412-45523434 CTGATGCCATTCCTAAGCATGGG - Intergenic
1026478597 7:70759683-70759705 CAGTGGCCTTTCCGGGGCCTTGG + Intronic
1030710340 7:112741650-112741672 CAGATACCACTCCTAGGGCTGGG + Intergenic
1032093438 7:128923575-128923597 CAGCTGCCATTCCATGGCCTCGG - Intergenic
1032414086 7:131722808-131722830 CAGAGGCCCTTCCTAGACAGAGG + Intergenic
1034297579 7:149988040-149988062 CAAGGGCAATTCCTGGGCCTTGG - Intergenic
1034712391 7:153205027-153205049 CAGGTGCCATTCCGAGTCCTGGG - Intergenic
1034808446 7:154108813-154108835 CAAGGGCAATTCCTGGGCCTCGG + Intronic
1034899077 7:154896332-154896354 CAGAGGCCATGCCTGGCCCCGGG - Intergenic
1035775487 8:2184276-2184298 CAGCGATCATTCCCAGGCCTGGG - Intergenic
1036433618 8:8712546-8712568 CAGAGCCAATTCTTTGGCCTAGG + Intergenic
1036651464 8:10646655-10646677 GAGAGGCCCTTCCTAGGCCCTGG - Intronic
1037561116 8:20075171-20075193 CCTTGGCCATTCCTAGGCTTGGG - Intergenic
1038286449 8:26210044-26210066 CCTAGGCCTTTCCTGGGCCTTGG + Intergenic
1038947255 8:32374949-32374971 CTGATGACATTCTTAGGCCTAGG - Intronic
1039612617 8:38931514-38931536 CAGAGGCCTTGCCTAGGTCTTGG + Intronic
1041242412 8:55859361-55859383 AAGAGGCCAATGCTAGGGCTGGG - Intergenic
1041670537 8:60487267-60487289 CAGAAGCCATGCCTGTGCCTGGG - Intergenic
1043373105 8:79615346-79615368 CAGAGCACAAACCTAGGCCTGGG + Intronic
1043373107 8:79615357-79615379 CAGTGGCCACGCCCAGGCCTAGG - Intronic
1043869257 8:85413028-85413050 CAGAAGCCATTCCTTCTCCTTGG + Intronic
1046512095 8:115214517-115214539 CAGCGGGCATTCCTTGGCCCAGG - Intergenic
1048178952 8:132177952-132177974 CAGAGCCCATTCCCACCCCTGGG + Intronic
1048553547 8:135455510-135455532 GAGAGGCCAGTCATAGACCTGGG + Intergenic
1051049037 9:12909639-12909661 CATAGTTCATTCCTAGGCATAGG - Intergenic
1052000038 9:23267114-23267136 CAGAGGCCATTGGTTGGCTTTGG - Intergenic
1056699705 9:88892104-88892126 CAGAGCCCAGTCCGAAGCCTTGG + Intergenic
1057014640 9:91641157-91641179 CAGCTACCATTCCTAGGGCTAGG + Intronic
1057172812 9:92973961-92973983 CAGAGACCATTTCTGGGCCATGG - Intronic
1058978650 9:110148681-110148703 CAGAGGACATGCCTAAGCCAGGG - Intronic
1059303632 9:113336130-113336152 CAGATGCCATTCATAGATCTAGG + Intronic
1060572188 9:124652252-124652274 GAGGGGACATTCCTAGGCCTTGG - Intronic
1061104100 9:128515701-128515723 CAGTGCCCATTCCTACGCCCTGG - Intronic
1061413910 9:130435564-130435586 CAAGGGCCATTTCTAGGCCCTGG + Intergenic
1061802455 9:133120052-133120074 CAGAGGCCATTCCTGGATCGGGG - Intronic
1185509207 X:650307-650329 GAGAGGCCATTCCTACGACAGGG - Intronic
1187601610 X:20838504-20838526 CCAAGTCCATTCCCAGGCCTCGG + Intergenic
1187947964 X:24444903-24444925 ATGAGGCCATTCCTAGGGCTTGG + Intergenic
1190687531 X:52888043-52888065 CAGAGGCTGTTTCTGGGCCTAGG - Intergenic
1190698451 X:52967749-52967771 CAGAGGCTGTTTCTGGGCCTAGG + Intronic
1192588443 X:72339625-72339647 CAGAGGCCATATCAAGGCCAGGG + Intronic
1193258338 X:79376804-79376826 CAAAGGTCATTCTTAGGTCTGGG + Intergenic
1195206258 X:102602464-102602486 CAAAGGCCATGCCTATGTCTAGG + Exonic
1195969193 X:110455579-110455601 CCGAGGCCAGTCCTAGTTCTTGG + Exonic
1196747919 X:119088055-119088077 CAGATGCCTTTCCCAGCCCTCGG - Exonic
1199109707 X:143916336-143916358 CAGAGTCTATTCCTATACCTAGG + Intergenic
1199362000 X:146931697-146931719 CAGAGGCCATGCATATTCCTTGG + Intergenic
1200063860 X:153495657-153495679 CTGAGGCCAGTCCTTGGCATGGG + Intronic
1200920930 Y:8612314-8612336 CAGAGGCCACTGCGAGGCCCAGG + Intergenic