ID: 1181058598

View in Genome Browser
Species Human (GRCh38)
Location 22:20271339-20271361
Sequence CGAGGTGAACAAAGGAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181058598_1181058605 3 Left 1181058598 22:20271339-20271361 CCATCCCTCCTTTGTTCACCTCG No data
Right 1181058605 22:20271365-20271387 GTCCCCTGAGAGGATCATGCAGG 0: 2
1: 0
2: 0
3: 9
4: 144
1181058598_1181058606 4 Left 1181058598 22:20271339-20271361 CCATCCCTCCTTTGTTCACCTCG No data
Right 1181058606 22:20271366-20271388 TCCCCTGAGAGGATCATGCAGGG 0: 2
1: 0
2: 1
3: 16
4: 120
1181058598_1181058602 -7 Left 1181058598 22:20271339-20271361 CCATCCCTCCTTTGTTCACCTCG No data
Right 1181058602 22:20271355-20271377 CACCTCGCCTGTCCCCTGAGAGG 0: 1
1: 0
2: 2
3: 14
4: 194
1181058598_1181058610 24 Left 1181058598 22:20271339-20271361 CCATCCCTCCTTTGTTCACCTCG No data
Right 1181058610 22:20271386-20271408 GGGTTTTCACTCAAAACTCCAGG 0: 1
1: 0
2: 1
3: 5
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181058598 Original CRISPR CGAGGTGAACAAAGGAGGGA TGG (reversed) Intronic
No off target data available for this crispr