ID: 1181058696

View in Genome Browser
Species Human (GRCh38)
Location 22:20271801-20271823
Sequence ACCCCCCAGCTCCCTGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 406}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181058696_1181058704 12 Left 1181058696 22:20271801-20271823 CCAGTGCCAGGGAGCTGGGGGGT 0: 1
1: 1
2: 1
3: 35
4: 406
Right 1181058704 22:20271836-20271858 TCTGCTCTCACCATGGAGGGCGG 0: 1
1: 1
2: 1
3: 19
4: 224
1181058696_1181058706 26 Left 1181058696 22:20271801-20271823 CCAGTGCCAGGGAGCTGGGGGGT 0: 1
1: 1
2: 1
3: 35
4: 406
Right 1181058706 22:20271850-20271872 GGAGGGCGGCTGCATGCCCAAGG 0: 1
1: 0
2: 6
3: 24
4: 253
1181058696_1181058701 8 Left 1181058696 22:20271801-20271823 CCAGTGCCAGGGAGCTGGGGGGT 0: 1
1: 1
2: 1
3: 35
4: 406
Right 1181058701 22:20271832-20271854 GCCATCTGCTCTCACCATGGAGG 0: 1
1: 0
2: 2
3: 21
4: 156
1181058696_1181058703 9 Left 1181058696 22:20271801-20271823 CCAGTGCCAGGGAGCTGGGGGGT 0: 1
1: 1
2: 1
3: 35
4: 406
Right 1181058703 22:20271833-20271855 CCATCTGCTCTCACCATGGAGGG 0: 1
1: 0
2: 3
3: 20
4: 166
1181058696_1181058700 5 Left 1181058696 22:20271801-20271823 CCAGTGCCAGGGAGCTGGGGGGT 0: 1
1: 1
2: 1
3: 35
4: 406
Right 1181058700 22:20271829-20271851 CCTGCCATCTGCTCTCACCATGG 0: 1
1: 0
2: 0
3: 27
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181058696 Original CRISPR ACCCCCCAGCTCCCTGGCAC TGG (reversed) Intronic
900092623 1:926997-927019 GCCGCCCAGCTCCCTGGCTACGG - Intronic
900192129 1:1356208-1356230 ACCCCCGAGGGCCCTGGCAGGGG + Intronic
900382608 1:2392152-2392174 ACCCCCCAGCACCCCGTCCCGGG - Intronic
900665733 1:3814342-3814364 AACCCCCAGCTCACTCCCACAGG + Exonic
900677336 1:3896099-3896121 CCTCCCCAGCTCCCAGGCAGCGG + Intronic
901008741 1:6185828-6185850 ACCTCCCACCTCCTTGGCATGGG + Exonic
901635933 1:10670114-10670136 GCCCCCGAGCTGCCTGGCAGTGG - Intronic
901740208 1:11336641-11336663 ACCCCTCAGGCCCCTGCCACAGG - Intergenic
902332815 1:15738892-15738914 AGCCCCCGGGTCCCAGGCACAGG + Intronic
902368120 1:15990445-15990467 CCCTCCCAGCACCCTGGCCCAGG + Intergenic
902515638 1:16988056-16988078 ACCTGCCAGCTCCAAGGCACAGG + Intronic
902621458 1:17653313-17653335 ACTTCCCAGTTTCCTGGCACAGG + Intronic
903333375 1:22608925-22608947 ACCCTCCAGCTCCCCAGCACTGG + Intergenic
903544809 1:24117288-24117310 AGCCTCCACCTCCCTGGCTCAGG - Intergenic
904035600 1:27557070-27557092 ACCCCCTTCCTCCCTGGAACAGG + Intronic
904678274 1:32211845-32211867 ACACCCCTGCTCCCTCACACTGG - Intronic
904850782 1:33457752-33457774 ACCACCCATCTCTCTGGCAGAGG - Intergenic
904923810 1:34029948-34029970 TCCTCCCACCTGCCTGGCACAGG - Intronic
906667455 1:47631814-47631836 GCCCCCCATCCCCCTGGCCCAGG - Intergenic
907794145 1:57697878-57697900 AACCCCAATCTCCCTAGCACTGG + Intronic
910494087 1:87806587-87806609 CTCCGCCAGCTCCCTGGGACCGG - Intergenic
910676642 1:89821849-89821871 GGCCCCCAGCTCCCTCCCACAGG - Intronic
911450484 1:98054400-98054422 ACCCTCCAGTGCCCTGGCGCTGG + Intergenic
912471464 1:109910175-109910197 GCCCCCCAGCTTGCTGTCACAGG + Intergenic
914661307 1:149793026-149793048 GCCCGCCAGCTCCCGGGCCCCGG + Intronic
914847475 1:151290995-151291017 ATCCCCCAGCCCCAGGGCACTGG - Exonic
915250923 1:154587968-154587990 ACCACACAGCTCCCTGACCCAGG + Intronic
915251196 1:154589915-154589937 TCCCCACAGCTCCCTCTCACTGG - Exonic
915320135 1:155051836-155051858 CCCGCTCAGCGCCCTGGCACCGG - Intronic
915519119 1:156431022-156431044 ACCCCCCAGCTCCCTAGACAAGG - Intergenic
915917680 1:159950795-159950817 CACCCCCAACTCCCTGGCAAAGG - Intergenic
915977354 1:160400210-160400232 AGCCCCCAGATCCCTGGGGCTGG - Intergenic
916037858 1:160936777-160936799 ACCCCCCACCTCCCTCCCAGAGG + Intergenic
917130665 1:171739198-171739220 ACCCCCTAGCTTCCTGGAAGGGG + Intronic
917145055 1:171881588-171881610 ACTCTCCAGCTCCCTGACCCTGG - Intronic
918214541 1:182382076-182382098 AGGCCCCAGCTACCTCGCACTGG + Exonic
919821609 1:201476513-201476535 AGCCCCCAGCTCCCAGGGAGAGG - Intergenic
920075927 1:203336549-203336571 AGCCCCAAGCTCCCTCTCACTGG - Intergenic
920383567 1:205550366-205550388 ACCCTCGACCTCCCTGGCTCAGG - Intergenic
920501691 1:206489618-206489640 AACTCCCAGCTCCCAGGCTCAGG - Intronic
921053019 1:211524600-211524622 ACCAGCCAGCTGCCTGCCACCGG - Intergenic
921057261 1:211552518-211552540 TCCCCGCAGCTCCCAGCCACTGG + Intergenic
921073704 1:211683352-211683374 ACCTCCCAGCTCTCTGTCTCTGG - Intergenic
921080942 1:211737933-211737955 CCCACCCAGCACCCTGGCACAGG + Intergenic
921903953 1:220476450-220476472 TTACCCCAGCTCCCTGGCCCCGG + Intergenic
922111776 1:222565778-222565800 AGCCTCCACCTCCCTGGCTCAGG - Intronic
922769860 1:228175899-228175921 ACCACCCCGCTTCCAGGCACAGG - Exonic
924608590 1:245555765-245555787 GCTCCCCTCCTCCCTGGCACTGG - Intronic
1062787759 10:279443-279465 ACCCCATAGGTCCCTGGCAGAGG - Intronic
1063998901 10:11646559-11646581 ACTCCCCACCTCCCCAGCACAGG + Intergenic
1065309771 10:24404037-24404059 AGCCCCCATCTCCCAGGCTCAGG + Intronic
1065501973 10:26391888-26391910 CCCCCCGAGCTCCGCGGCACTGG + Intergenic
1069405185 10:68091474-68091496 AACCTCCAGCTCCCAGGCTCAGG + Intergenic
1070127719 10:73635461-73635483 AACCTCCACCTCCCTGGCTCAGG + Intronic
1070349300 10:75576388-75576410 AACCCCCACCTCCCTGCAACAGG + Intronic
1070801758 10:79248019-79248041 TCTCCCCACCTCTCTGGCACAGG - Intronic
1072326032 10:94299711-94299733 ACCAGCTAGCTACCTGGCACTGG + Intronic
1072850988 10:98891849-98891871 AACCTCCACCTCCCTGGCTCAGG + Intronic
1072908345 10:99476367-99476389 ACCCTCCACCTCCCAGGCTCAGG - Intergenic
1073064869 10:100752257-100752279 ACCCTCCAGCTCCCTCGGCCTGG + Intronic
1073483689 10:103803007-103803029 ACCTCCCAGGTGCCTGGAACAGG + Intronic
1073485911 10:103819182-103819204 ACACCAGAGCTCCCTGGGACTGG - Intronic
1073536238 10:104279229-104279251 ACCCCCCAGCTCCCTGTGAGAGG - Intronic
1074052388 10:109892036-109892058 AGACCCAAGCTACCTGGCACTGG + Intronic
1074610216 10:115014567-115014589 GCCTCCCAGCCCCCTGACACTGG - Intergenic
1074923620 10:118046180-118046202 GCCCCCGAGTTCCCTAGCACAGG + Exonic
1075444809 10:122505884-122505906 TCCCCCCAGCTCCTTGGCCTGGG + Intronic
1076103720 10:127803592-127803614 ACCCGCCAGAGCCCTGGCCCAGG + Intergenic
1076365425 10:129918644-129918666 CCTCCCCAGCTCCCTGCCCCAGG + Intronic
1076539617 10:131205918-131205940 ACCCCACAGAGACCTGGCACAGG - Intronic
1076690111 10:132219503-132219525 ACACCCCAGAGCCCTGGCTCTGG + Intronic
1076844517 10:133062718-133062740 ACTCCACACCACCCTGGCACTGG - Intergenic
1077181528 11:1219250-1219272 AGCCTCCTGCTCCCTGGCACGGG - Intergenic
1077253075 11:1569145-1569167 ACCCCCCAACCCCTAGGCACTGG - Intronic
1077401398 11:2359778-2359800 ACCCACCTGCCCCCAGGCACTGG - Intergenic
1077401422 11:2359862-2359884 ACCCACCCGCCCCCAGGCACCGG - Intergenic
1078606918 11:12785138-12785160 TCCCCACGGCTCCCAGGCACAGG - Intronic
1078617383 11:12878609-12878631 ACCCCTCAACTCCTTTGCACTGG - Intronic
1078999627 11:16740482-16740504 AGCCTCCACCTCCCTGGCTCAGG + Intronic
1080424149 11:32140556-32140578 ACACACCAGCTCCCTGCCCCTGG - Intergenic
1080663671 11:34317339-34317361 AACCCCCAACTCCCTTGCCCAGG - Intronic
1081252310 11:40850751-40850773 AACTCCCATCTCCCTGGGACAGG - Intronic
1081570238 11:44286245-44286267 CCCCGGCAGCTCCCTGGCCCTGG + Intronic
1081773623 11:45664247-45664269 AGCCTCCAGCTCCCTGTCAATGG + Intronic
1082765579 11:57164891-57164913 ACCCCCCACCTGCCTGGTCCTGG - Intergenic
1083341310 11:61960050-61960072 CCCACCCAGCCCCCTGGCTCTGG - Intronic
1084150553 11:67286108-67286130 AACCCCCAGCACCCGGGCTCAGG + Exonic
1084189384 11:67492077-67492099 ACCACCCACCACCCTGGCACGGG - Exonic
1084414795 11:69025544-69025566 ACCCCAGAGTTCCCTGGCAGTGG - Intergenic
1085317349 11:75553597-75553619 TTCCTCCAGCTCCCTGACACAGG - Intergenic
1085414266 11:76309931-76309953 ACCCTCCACCTCCCAGCCACTGG - Intergenic
1088779005 11:113115497-113115519 ACCCTCCACCTCACTGGCAAGGG + Intronic
1089257812 11:117203205-117203227 GCCCCCCAGCGCCCTAGCCCAGG - Intronic
1089450704 11:118594179-118594201 ACCCTCCACCTCCCAGGCCCAGG + Intronic
1089526543 11:119100970-119100992 ACCTCCCAGGTCCCAGCCACAGG + Intronic
1089633561 11:119797969-119797991 CCTCCCCTGCTCCCTGGAACAGG - Intergenic
1090334611 11:125954220-125954242 ACGCCCCAGCTCCTGGGCCCAGG - Intergenic
1091305769 11:134535250-134535272 ACCCCTCTGCTGCCTGGCTCCGG - Intergenic
1093027685 12:14259781-14259803 ACCCGCCACCTCACTGGCAACGG + Intergenic
1095810768 12:46371928-46371950 AACCCCCAGCTCCCGGGGCCCGG - Intronic
1097261097 12:57720705-57720727 TTCCCCCAGCTGCCTGGCCCAGG + Intronic
1100346596 12:93737787-93737809 ACTACACAGCTCCCTGGCCCGGG - Intronic
1101343185 12:103861032-103861054 ACCCCAGACCTCCCTGCCACTGG + Intergenic
1103613051 12:122135639-122135661 AGCCCCCAGGTCACTGTCACAGG + Exonic
1103730321 12:123022977-123022999 TTCTCCCAGCTCCCTGCCACAGG + Intronic
1104289286 12:127454243-127454265 AGCTCCCAGCTCCCTGGGGCTGG - Intergenic
1104659031 12:130595776-130595798 TCTCCCCTGCTCCCTGGCACAGG - Intronic
1104864474 12:131944714-131944736 AACCCCCACCTGCCTGGCACCGG - Exonic
1104904566 12:132206242-132206264 ACCCCTCAGGGCCTTGGCACAGG + Intronic
1104957083 12:132472156-132472178 GCCCCCCAACTCCCTGTTACCGG - Intergenic
1106335366 13:28778416-28778438 AGGCCCCAGCTCCCTGGGCCAGG - Intergenic
1106361854 13:29038664-29038686 AACTCCCATCTCCCTGGGACAGG - Intronic
1106416894 13:29553330-29553352 GCCACCCAGCTCCTGGGCACTGG - Intronic
1108393966 13:49975191-49975213 AGCCTCCATCTCCCTGGCTCAGG + Intergenic
1110762325 13:79244341-79244363 AACCCCCACCTCCCAGGCTCAGG + Intergenic
1111040400 13:82740422-82740444 ACTCCCGAGCTGCCTGCCACAGG + Intergenic
1112196115 13:97228057-97228079 CCCCCCCAACTCCCTGTAACAGG - Intronic
1113568879 13:111339327-111339349 GCTCCCCAGCTCCCTGGAAATGG - Intronic
1113889528 13:113728644-113728666 ACGCCCCGGCTCCGTGGAACAGG + Intronic
1114618873 14:24082818-24082840 GCCCCCCAGCCCCCTGGCCATGG - Exonic
1115591813 14:34873423-34873445 ACCCCCTTGCTCCGTGTCACAGG + Intronic
1118322789 14:64763181-64763203 ATCCCCCACCTCCCAGGCTCTGG - Intronic
1119041766 14:71280923-71280945 ACCCCTCAGCTCCTTGGGAATGG + Intergenic
1120764485 14:88316141-88316163 CCTCCCCATCTCCCTGGCTCTGG + Intronic
1120859371 14:89241081-89241103 ACCCCCCATATCACTGACACTGG + Intronic
1121339288 14:93095462-93095484 TCCCTCCAGCTGCCTGCCACAGG - Intronic
1121501834 14:94444152-94444174 ACCCCCCAGCCAACTGGCGCGGG - Intronic
1121530790 14:94651715-94651737 CCCCCCCACCCCCCAGGCACAGG - Intergenic
1122097486 14:99382167-99382189 AGCCCCCTCCTCCCTGACACGGG + Intergenic
1122179795 14:99946749-99946771 CCGCCCCAGCTCCCTAGCGCAGG - Intergenic
1122549936 14:102544413-102544435 TCCTCCCAGTTCCCTGGCAAGGG - Intergenic
1122822608 14:104354919-104354941 AGCCCCCAGCCCCCTGCCCCCGG - Intergenic
1122822633 14:104354961-104354983 AGCCCCCAGCCCCCTGCCCCCGG - Intergenic
1122996224 14:105266329-105266351 AACCTCCAACTCCCTGGCTCAGG - Intronic
1123004633 14:105315224-105315246 GCCCCCCAGGTCCCGAGCACCGG + Exonic
1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG + Intronic
1124221891 15:27856452-27856474 CCCCCACAGCTTCCTGCCACAGG - Intronic
1124603184 15:31151486-31151508 GCCACACAGCTCCTTGGCACAGG + Intronic
1127455590 15:59153588-59153610 ACCCTGCAGCTCCCTGGTCCGGG + Exonic
1128106208 15:65046829-65046851 AACCTCCATCTCCCGGGCACAGG - Intronic
1128549968 15:68591674-68591696 GACACCCAGCTCCCAGGCACAGG - Intronic
1129116946 15:73369672-73369694 ACGCCCCAGCACTCTGGAACTGG + Intergenic
1129323010 15:74784968-74784990 ACCCACCTGCTCCCTAGCTCTGG - Intronic
1129834859 15:78695976-78695998 AGCCCCCAGACCCCTGCCACAGG + Intronic
1131248291 15:90814642-90814664 ACCCCACAGCTGCCTTGCTCTGG + Intronic
1131885062 15:96903712-96903734 ACCTCCGACCACCCTGGCACTGG + Intergenic
1132650983 16:1021340-1021362 AACTCCCAGCTCCCGGGCTCAGG - Intergenic
1132977989 16:2720016-2720038 AGCCCCCTACTCCCTGGGACAGG - Intronic
1135226980 16:20669480-20669502 ACACCCCAGCTGCTTGGCCCTGG + Intronic
1135283929 16:21176816-21176838 ACCCCCAACCTCCCAGGCTCAGG - Intronic
1135778507 16:25277961-25277983 AGCCCCCACCTCCCAGGCTCAGG - Intergenic
1135934251 16:26766205-26766227 AGCCTCCAGCTCCCTCTCACTGG - Intergenic
1136277362 16:29186932-29186954 CGCCCCCAGCACCCTGGCTCCGG + Intergenic
1136280822 16:29210166-29210188 ACCCCCCAGCCCTCTGGGAGTGG - Intergenic
1137629310 16:49931020-49931042 ACCCCCCTGCTGCCTGCCACAGG - Intergenic
1137709393 16:50555730-50555752 ACCCCCCAGCTCACCAGTACCGG - Intronic
1137899296 16:52247119-52247141 ACCCACTGGCTCCCTGGCAATGG + Intergenic
1138390852 16:56669021-56669043 ACTTCCCAGCTCCCTGACCCTGG - Intronic
1138549575 16:57740203-57740225 AACTCCCAGCGCCCTGGCCCAGG + Intronic
1139512300 16:67434388-67434410 AAGCCCAAGCTCCCTGGCTCAGG - Intronic
1139782596 16:69364261-69364283 CCCTCCCTGCTCCCTGGCAGCGG + Intronic
1140869413 16:79092856-79092878 ACCCCCCAGCTCCATAGGAGTGG + Intronic
1141607438 16:85162676-85162698 TTTCCCCAGCTCTCTGGCACTGG - Intergenic
1141645471 16:85365080-85365102 ACCCCACAGCTGCCAGTCACTGG - Intergenic
1141807684 16:86352501-86352523 ACCCCCCAGCTCCTGGGTGCAGG - Intergenic
1142029124 16:87829704-87829726 CCCCTGCAGCTCCCTGGGACTGG + Intergenic
1142085178 16:88176088-88176110 ACCCCCCAGCCCTCTGGGAGTGG - Intergenic
1142129951 16:88427924-88427946 ACCCCCCAGGGCCCTGGGACTGG + Exonic
1142420383 16:89966227-89966249 TCCCCCCAGCTCCCTGCCCATGG - Exonic
1143029388 17:3959479-3959501 ACCCCCCTTCTCCCTGGCTCTGG - Intronic
1143090653 17:4447556-4447578 ACACGCCAGCTCCCCGGCACTGG - Intronic
1143401827 17:6651267-6651289 CCCCACCAGCTCCCTGGCGTGGG - Intronic
1143495179 17:7308324-7308346 TCCCCCCAGGTCCCGGCCACCGG + Intronic
1143638319 17:8179829-8179851 ACCCTCGACCTCCCTGGCTCAGG + Intergenic
1143778943 17:9219369-9219391 ACACCCCTGCTCCATGGCACTGG - Intronic
1144131338 17:12250327-12250349 ACTGCCCAGTTCCCTGACACAGG + Intergenic
1144728874 17:17515363-17515385 TCCCACCCGCTCCCTGGCCCCGG - Intronic
1144854153 17:18258732-18258754 TCCCCCCAGCGCCCTCGCCCCGG - Exonic
1146840883 17:36153384-36153406 GCCACCCATCTCCCTGGCTCTGG + Intergenic
1148633950 17:49132916-49132938 AACCGCCCGCTCCCTGGCTCCGG - Intronic
1148816256 17:50330103-50330125 ACCCTCTTCCTCCCTGGCACTGG + Intergenic
1148836871 17:50470005-50470027 AGCTCCAAGCTGCCTGGCACAGG + Intronic
1149486523 17:57046629-57046651 GCCCACCGGCTCCCTGGCTCGGG + Intergenic
1150445793 17:65226109-65226131 AACCCCCAGTTCCCTGAGACAGG + Intronic
1150631879 17:66885576-66885598 ACCCCCCAACTTCATGGCCCTGG + Intergenic
1150823783 17:68457303-68457325 GTCCCCCACCTCCCTGGCAGGGG + Intronic
1151390841 17:73785793-73785815 ACCTCACAGCTCCTAGGCACTGG - Intergenic
1151490025 17:74427349-74427371 ACTCGCCTGCTCCCTGGCCCTGG + Intronic
1151543415 17:74776837-74776859 AGCCCCCAGCTCCCTGCCCTAGG + Intronic
1151556263 17:74848189-74848211 GCCCCCCACTTCCCTGGGACAGG + Intronic
1151656176 17:75497029-75497051 GCCCCCGAGCTCCCTTGCCCTGG - Intronic
1152147980 17:78580693-78580715 ACCCCAGAGCTCCCAGACACAGG + Intergenic
1152218342 17:79047381-79047403 TGCCCCCAGCCCCCTGCCACGGG - Intronic
1153897578 18:9580731-9580753 CTCCCGCAGCTCCCGGGCACAGG + Intronic
1156162363 18:34374504-34374526 ACCTCCCACCTCCATGGGACAGG - Intergenic
1156458412 18:37307586-37307608 ACCCCCCAGCCCACAGGCATGGG - Intronic
1157286699 18:46381917-46381939 ACTCCCTTGCTCTCTGGCACGGG + Intronic
1157591169 18:48837129-48837151 ACCCCCCAGCCCCTGGGCATTGG - Intronic
1158494476 18:57942140-57942162 TCCCTGCAGCTCCCTGGCCCTGG - Intergenic
1158592603 18:58790223-58790245 ACCCCCCACCTCCCATGCACAGG - Intergenic
1159040636 18:63320279-63320301 TCCGCCCCGCTCCCTGGCCCGGG + Intergenic
1160129559 18:76212789-76212811 TCCCCCCAGCTCCCTCTCTCCGG + Intergenic
1160927644 19:1554567-1554589 ACCCCCCAGTTCCGTGGTCCAGG - Intergenic
1161014724 19:1978034-1978056 CCCCCCCACCTCCCTAGCCCAGG - Intronic
1161301408 19:3544668-3544690 TCCCCACAGTTCCCTTGCACAGG + Exonic
1161662293 19:5554292-5554314 TCCCCACCGCTCCCTGGCGCTGG + Intergenic
1161702422 19:5802725-5802747 ACCCCCACGCTGCCTGGCACTGG - Intergenic
1162007316 19:7788780-7788802 ACCCCGCGGCTCCCAGGCTCGGG + Intergenic
1162418593 19:10552993-10553015 ACACTCCGGCTCCCTCGCACAGG + Exonic
1162819228 19:13212598-13212620 ACACTCCACCTCCCTGGCAGGGG + Intronic
1162964984 19:14151342-14151364 TCGCCCCCGCCCCCTGGCACAGG + Exonic
1164830401 19:31315518-31315540 CACACCCAGCTCCCTGGCAGAGG - Intronic
1165817397 19:38650422-38650444 ACCTCCCAGCTCCCTTCCTCTGG + Intronic
1166197669 19:41217707-41217729 AGCTCCCAGCTCCTTGTCACTGG - Intergenic
1166358189 19:42239873-42239895 AGCCTCCAGCTCTCTGGCTCAGG + Intronic
1167571615 19:50292412-50292434 ACCTCCCAGCTTCCTGTCCCAGG - Intronic
1168164603 19:54538102-54538124 ACCTCCCAGCTCCATGACCCTGG + Intronic
1168240111 19:55084621-55084643 ACCCCCCCTCTCCCCTGCACAGG + Intronic
1168287114 19:55340505-55340527 ACCCTCCAGGTCCCTTGCCCTGG + Intronic
1168403049 19:56097102-56097124 AGCCCCCAGCTCCACGGCCCAGG + Intronic
925365836 2:3311738-3311760 AGCCCCCTGCACCCTGGGACTGG - Intronic
926123180 2:10255853-10255875 ACCCCCCAGCACCCACACACGGG + Intergenic
926229739 2:10993256-10993278 CCCCGCCTGCTCCCTGGCAGTGG - Intergenic
927513422 2:23658468-23658490 ACCCCCCAGCTGCTCAGCACAGG + Intronic
927712815 2:25336286-25336308 CACCCCCATTTCCCTGGCACTGG + Intronic
927856367 2:26530212-26530234 ACACCCCACCTCCCTTTCACAGG - Intronic
928319022 2:30268572-30268594 ATCCCCCTGCTCCCAGGCCCAGG - Intronic
928517996 2:32062134-32062156 AACCTCCACCTCCCTGGCTCAGG - Intergenic
929023778 2:37579286-37579308 CTGACCCAGCTCCCTGGCACAGG - Intergenic
929111557 2:38409174-38409196 TCCACCCACCTACCTGGCACAGG - Intergenic
929174106 2:38959912-38959934 GCCCTCCAGCTCCCAGTCACTGG - Exonic
929570207 2:43018176-43018198 AGCTCCCAGCTCCCATGCACTGG - Intergenic
929857541 2:45650026-45650048 AATCCCCAGCTCCCCGGCAGCGG + Intergenic
933061854 2:77747851-77747873 ACCCCCCAGTTCCCAGGCAAAGG + Intergenic
933902887 2:86861951-86861973 CCCCCCCAGCTCCCCGACCCAGG - Intergenic
934571442 2:95375363-95375385 ACCCCAGAGCTCACTGGCCCAGG - Intronic
934769435 2:96898570-96898592 AGCCCCAACCTCCCTGGCTCAGG - Intronic
935181325 2:100693364-100693386 ACCCCCCAGCTCCTGTGCAGTGG + Intergenic
935653152 2:105399117-105399139 ACGCCTCGGCTCGCTGGCACCGG + Intronic
935777658 2:106487319-106487341 CCCCCCCAGCTCCCCGACCCAGG + Intergenic
937208933 2:120254757-120254779 AGCCCCCACCTCCCAGGCTCAGG + Intronic
937224398 2:120359935-120359957 ACCCCCTACCTACCTGGGACAGG - Intergenic
937248746 2:120510468-120510490 TCCCCCCAGGACCCTGGCCCAGG - Intergenic
937855941 2:126672055-126672077 ATCCCCCAGCCACCTGGCCCTGG - Intronic
937892314 2:126948166-126948188 ATGCCCCAGCTGCCTGGGACTGG - Intergenic
938409538 2:131052627-131052649 ACCCCCCACCTGCCTGCTACAGG - Intronic
939483522 2:142779234-142779256 ACCCCTCAGTTCACTGGCTCTGG + Intergenic
942099046 2:172559926-172559948 AACCTCCACCTCCCTGGCTCAGG + Intronic
946201738 2:218074481-218074503 CCCCACCAGCTTCCAGGCACTGG + Intronic
946411940 2:219519879-219519901 AGCCCCCAGCCCCCAGACACAGG - Intronic
947767168 2:232645249-232645271 ACGCCTCAGCCCCCTGCCACGGG + Intronic
948711314 2:239827408-239827430 CCCCAGCAGCTCCCTGCCACAGG + Intergenic
948850685 2:240703937-240703959 AACCCTCAGCTCCCTGGGATGGG + Intergenic
948909522 2:240996150-240996172 AACCCCCAGCTCCCCGGGCCCGG + Intergenic
948943753 2:241209263-241209285 ACGCCCCCGCTCCCTGCCACAGG + Exonic
1169266732 20:4171687-4171709 AACCCCCAGCTCCCTGCACCTGG - Intronic
1169417707 20:5432133-5432155 ACACCCCAGCTCACAGTCACTGG + Intergenic
1169889787 20:10439867-10439889 ACTCCCCATCTCCCTGACAAAGG - Intronic
1170011459 20:11728304-11728326 ACCACCCAGTCCCCTGGCACCGG - Intergenic
1171194742 20:23187965-23187987 ACCTCCCTGCAGCCTGGCACTGG + Intergenic
1172886106 20:38231943-38231965 ACCGCCCAGATTCCTGGAACAGG - Intronic
1173790937 20:45827363-45827385 ACCTCCCTGCTCCCCAGCACTGG + Intronic
1174282647 20:49450374-49450396 TCCCCACCCCTCCCTGGCACAGG + Intronic
1174487230 20:50869216-50869238 TCTCTCAAGCTCCCTGGCACTGG + Intronic
1176060231 20:63169301-63169323 AGCCCACAGATCCCAGGCACAGG + Intergenic
1177071337 21:16512592-16512614 AACCTCCACCTCCCTGGCTCAGG + Intergenic
1179515355 21:41902816-41902838 ATGCCCCAGCTCCGTGGCTCTGG - Intronic
1179635753 21:42707622-42707644 AGCCCCCAGCTCCTTGTCTCCGG + Intronic
1179828143 21:43979783-43979805 AGCACCCAGCTCCCTGCCTCCGG - Intronic
1179889875 21:44330124-44330146 ACCCTCCAGCTCCCGGGGGCTGG + Exonic
1180071006 21:45435779-45435801 CCCCCGGCGCTCCCTGGCACAGG + Intronic
1180784047 22:18537091-18537113 TCGCCCCAGCTCCCTGGGGCCGG + Intergenic
1180842752 22:18966933-18966955 GCCCCCCAGCTCCCTGGCACCGG + Intergenic
1180856733 22:19051642-19051664 AACCTCCAGCTCCCGGGCTCAGG - Intronic
1181058696 22:20271801-20271823 ACCCCCCAGCTCCCTGGCACTGG - Intronic
1181240948 22:21476443-21476465 TCGCCCCAGCTCCCTGGGGCCGG + Intergenic
1181618306 22:24070420-24070442 CCCCTCCAGAGCCCTGGCACTGG + Intronic
1182071353 22:27465895-27465917 ACCCAGCAGCTCCCTGGGATGGG - Intergenic
1182284336 22:29235869-29235891 AGCCCCAACCTCCCTGGCTCAGG + Intronic
1182473339 22:30561795-30561817 ACCCCTCAGGTGGCTGGCACGGG - Intronic
1182518163 22:30870692-30870714 CACCCCCACCGCCCTGGCACGGG + Intronic
1184120419 22:42446281-42446303 CCCCCCCAGCTCCCTCCCACAGG + Intergenic
1184132127 22:42523178-42523200 CCCCCCCAGCTCCCTCCCACAGG + Intergenic
1184246696 22:43239413-43239435 ACCCCTCGGCTCCCTGGCCGGGG - Intronic
1184792282 22:46707540-46707562 ACCCACCTGCTCCCGGGCACCGG + Intronic
1185253054 22:49815794-49815816 CCTCCCGAGCTCCCAGGCACTGG + Intronic
1185323744 22:50215620-50215642 CCCCCCCACCCCCCTGGCACAGG - Intronic
1185342606 22:50298389-50298411 AGCCCCCAGGCCCCTTGCACGGG + Intronic
951415492 3:22417279-22417301 CACCCCCTGCTCCATGGCACCGG + Intergenic
953568276 3:44051561-44051583 ACCACCAGCCTCCCTGGCACTGG + Intergenic
953581502 3:44161277-44161299 AGACCCCAGCTCCTTTGCACTGG + Intergenic
953698949 3:45181255-45181277 ATCCCCCAGCTTCCAGGCTCGGG - Intergenic
954364464 3:50138781-50138803 ACCCGCCAGCTCCCTGAAGCAGG - Intergenic
954379009 3:50209783-50209805 AGCCCCCAGCTCCCTGGCCTTGG - Intronic
956383027 3:68686076-68686098 AACTCCCATCTCCCTGGGACAGG - Intergenic
958483639 3:94676421-94676443 TCACCCCATCTCACTGGCACCGG - Intergenic
958573086 3:95912256-95912278 ACCCCCTTGCTGCCTGGGACAGG + Intergenic
958594153 3:96200843-96200865 TCCCCCCAGCTTCCTTGCCCTGG + Intergenic
959429583 3:106236312-106236334 AACCTCCACCTCCCTGGCTCAGG - Intergenic
961015859 3:123467763-123467785 ACCCCCGAGATTCCTGACACTGG - Intergenic
961732191 3:128973831-128973853 ACAACTCAGATCCCTGGCACGGG + Intronic
963004853 3:140717351-140717373 TCCCCCCACCTCCCTGCTACTGG - Intergenic
964151548 3:153531693-153531715 CCTCCCCAACTCCCTGGCAGTGG + Intergenic
964811333 3:160667784-160667806 ACCCTCCTGGTACCTGGCACAGG + Intergenic
967791069 3:193549748-193549770 ACCCTCAACCTCCCAGGCACAGG - Intronic
967930398 3:194686675-194686697 TCCCCCCAACTCCCTACCACAGG + Exonic
968462751 4:733435-733457 AGCCCCCGGCTCCCCCGCACTGG - Intronic
968591050 4:1459862-1459884 GCCCCCCAGGACCCTGGCAAAGG + Intergenic
968727691 4:2255892-2255914 CACCCCCAGCTCCCCGGCAGCGG - Intronic
968749343 4:2379162-2379184 ACCTCCTTGCTCTCTGGCACGGG - Intronic
969114102 4:4860474-4860496 AGCCCACGGCTCCCTAGCACCGG - Intronic
971430029 4:26556143-26556165 AACTCCCATCTCCCTGGGACTGG - Intergenic
972109752 4:35542309-35542331 ACCCACTAGCTCCCTGGCAATGG + Intergenic
973553679 4:52060317-52060339 ACCCACGAGCTGCCTGGCTCTGG - Intronic
978107814 4:104925754-104925776 CCACCCCTGCTCCCTGCCACTGG - Intergenic
978327885 4:107579521-107579543 CCACCCAATCTCCCTGGCACCGG - Intergenic
979100315 4:116604304-116604326 CCCCCCCCGTTCCCTGGCTCTGG + Intergenic
981064772 4:140470964-140470986 AGCCTCCACCTCCCAGGCACTGG + Intronic
981588266 4:146328031-146328053 CCCACCCTGCTCCCTGCCACTGG + Intronic
983133977 4:164056863-164056885 ACCTCCCATCTCCCTAGGACAGG + Intronic
984587178 4:181578071-181578093 ACCCTCCAGCTCCCTGGAAGTGG + Intergenic
984701046 4:182819087-182819109 GCCTCCCTTCTCCCTGGCACTGG - Intergenic
985651764 5:1111004-1111026 GCCTCCCTGCTCCCTGGCAGTGG - Intronic
985670603 5:1204673-1204695 CCCCCCCAGCTCCTCTGCACAGG + Intronic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
986244793 5:5997593-5997615 ACCCGCCATCACCCTGCCACAGG - Intergenic
989385739 5:40853275-40853297 AATCCCCAGCTCCCTGGCCAGGG - Exonic
989665199 5:43846174-43846196 ACCCCCCAGATGCCTGGGACAGG - Intergenic
990438597 5:55821298-55821320 ACCCCCAAGATCCCAGGGACTGG - Intergenic
991083870 5:62630575-62630597 AGCCTCCACCTCCCTGGCTCAGG + Intergenic
992571661 5:78065409-78065431 ACCACCGAGCTCCCGGGCAAGGG + Intronic
992645138 5:78804766-78804788 ACCTCCCAGCTCCCGGACAGTGG + Intronic
995324030 5:110871927-110871949 ACCACCAGGCTCCCTGGCTCAGG - Intergenic
998641321 5:144014542-144014564 ACCCACCAGCTCCTAGACACTGG - Intergenic
999002668 5:147940612-147940634 CTCCCCCACCTCCCTGGCAGGGG - Intergenic
999145434 5:149390217-149390239 ACCCCCCCCCTCCCTGTCCCTGG + Intronic
1000103346 5:158037041-158037063 ACCCCCCACCTCCCTCCCAGAGG + Intergenic
1000132487 5:158313528-158313550 ACCCCCTAGAGCCCTGGCAAAGG + Intergenic
1000478731 5:161744701-161744723 ATCCCCCAGGTCACTGGCTCTGG + Intergenic
1001442166 5:171751258-171751280 CCTCCCCAGTTCCCTGGCCCAGG + Intergenic
1002091990 5:176811191-176811213 ACCCCCCATTTCCTGGGCACTGG - Intronic
1002095935 5:176831080-176831102 ACCCCCCACCTCCGTGCCTCGGG + Intronic
1002194138 5:177493177-177493199 ACCCCCCAGCACCCTGTCGGGGG + Intronic
1002212130 5:177605292-177605314 ACCCTCCAGTGCCCAGGCACAGG - Intronic
1003058205 6:2841709-2841731 ACCCCCCACCCCCCAGGCTCAGG - Intronic
1004850245 6:19691729-19691751 CGCCCCCAGCTCCTTGGCAGAGG + Intergenic
1006030094 6:31171861-31171883 CTCCCCCACCTCCCTGGCCCAGG + Intronic
1006376535 6:33674425-33674447 GCCCCCCAGATCTCTGGGACTGG - Intronic
1006395748 6:33786402-33786424 ACCCTCAAGCTCCCTGGCACTGG - Intronic
1006670705 6:35728248-35728270 ACTCGGCAGCTCCCTGGAACGGG + Intronic
1006846888 6:37068603-37068625 GCCCCTCTGCTCCCAGGCACTGG - Intergenic
1007773307 6:44208470-44208492 TACCCCCAACTCCCTGGCCCTGG + Intergenic
1008033307 6:46720511-46720533 ACCCCCAGGCACCCTGGCACTGG - Intronic
1008352441 6:50507899-50507921 ACCCTCCACCTCCCAGGCTCAGG + Intergenic
1008724461 6:54400129-54400151 CCACCCCACCTCCCTGCCACTGG - Intergenic
1008785146 6:55158823-55158845 AACTCCCATCTCCCTGGGACAGG + Intronic
1013180945 6:107716539-107716561 ACCCCCCACAGCCCTGGCAAAGG - Intronic
1013289485 6:108708252-108708274 GCCCCCCAGCTCCCTGGATTAGG + Intergenic
1014394070 6:120902537-120902559 AGCCCCAACCTCCTTGGCACAGG + Intergenic
1015704892 6:136077036-136077058 TCCTCCAGGCTCCCTGGCACAGG - Intronic
1016461895 6:144286435-144286457 ATCGCCAAGCTCCCTGGCAGCGG + Intronic
1017505808 6:155067720-155067742 AGCCTCCACCTCCCTGGCTCAGG + Intronic
1018197679 6:161369018-161369040 GCCCCCCAGGTCCCTGGGGCTGG - Intronic
1018294263 6:162328838-162328860 ACCCCCCTGCTCTCTGGCCCAGG - Intronic
1018614075 6:165669454-165669476 ACTCCAGAGCTCCTTGGCACTGG + Intronic
1018696522 6:166395733-166395755 CCCTCCCAGCTCTCTGCCACTGG - Intergenic
1018794052 6:167172201-167172223 CAGCCCCAGCTCCCGGGCACGGG - Exonic
1018822283 6:167382876-167382898 CAGCCCCAGCTCCCGGGCACGGG + Exonic
1019133569 6:169894580-169894602 GACCCCCAGCTCCCGGGGACAGG + Intergenic
1019257455 7:61299-61321 ACCTCCCAGGCCCCTGGCCCCGG + Intergenic
1019547225 7:1584328-1584350 AGCCCCCACCTCATTGGCACTGG + Intergenic
1019568092 7:1694589-1694611 ACCCCCCACCTCCCTGAGACAGG + Intronic
1019649590 7:2149546-2149568 ACCCGCCAGGCCCCTGGCACAGG + Intronic
1020169413 7:5833416-5833438 ACCCCCCGCCTCGCGGGCACAGG - Intergenic
1021991909 7:26148280-26148302 ACCCCCCAGCTCCCTCCCGGAGG - Intergenic
1021991932 7:26148327-26148349 ACCCCCCAGCTCCCTCCCGGAGG - Intergenic
1021991955 7:26148374-26148396 ACCCCCCAGCTCCCTCCCGGAGG - Intergenic
1024299143 7:47873153-47873175 ACCACCCAGCTTCCTCCCACCGG - Intronic
1024548169 7:50539452-50539474 ACCCCCCTGCTCCAAGGCTCTGG + Intronic
1026477634 7:70750480-70750502 ACCCTCCACCTCCCAGGCTCAGG + Intronic
1026578207 7:71592090-71592112 ACTGCCCAGTTCCCTGGCCCTGG - Intronic
1026894369 7:74001364-74001386 ACTCCCCAGCCTCCTGGTACAGG - Intergenic
1029692120 7:102189475-102189497 ACCCTCCAACTCCCGGGCTCAGG + Intronic
1031757097 7:125658742-125658764 AACCCCCATCTCCCTGTCCCTGG + Intergenic
1032587798 7:133163787-133163809 ATCCCCAACCTTCCTGGCACTGG + Intergenic
1032659708 7:133969966-133969988 AACTCCCATCTCCCTGGGACAGG - Intronic
1033249381 7:139745720-139745742 ACCCCCCAACTTCCAGGCAGTGG + Intronic
1033278446 7:139989633-139989655 CCTCCCCATCTCCCTGGCCCGGG + Intronic
1033283366 7:140021520-140021542 ACACCCCAGCTGCCCAGCACTGG + Intergenic
1033457479 7:141515929-141515951 GCCGCCCAGCTCCTTGGCCCAGG - Intergenic
1035222135 7:157412283-157412305 ACCCACCAGCACCCTGACACCGG - Intronic
1035269268 7:157710483-157710505 ACCCCCCCGCCCCGTGGCACAGG + Intronic
1035463569 7:159061570-159061592 AGCCTCCACCTTCCTGGCACAGG - Intronic
1035719975 8:1784649-1784671 AAGCCCCATGTCCCTGGCACAGG + Exonic
1035749122 8:1983380-1983402 AGCACCCAGCTGCCTGGGACAGG - Intronic
1036752360 8:11451288-11451310 GGCCCCCAGCTCCTTGCCACTGG - Intronic
1037407053 8:18554137-18554159 ACCCCCCACCTCCTGGGGACAGG + Intronic
1037825058 8:22155936-22155958 CCCTCCCAGCACCCTGGCATGGG - Intronic
1037891225 8:22624659-22624681 GCCACCCAGCTCCCTGGACCTGG - Intronic
1038033010 8:23661356-23661378 ACCCCCCACCTCCCTGCCGCTGG - Intergenic
1039407992 8:37329166-37329188 AGCCCAGAGCTCCCTGCCACTGG + Intergenic
1039475824 8:37838966-37838988 GCCCCCCACCTCCCTGGGAAAGG - Exonic
1039800469 8:40950245-40950267 GCCCCCCATCTCCCTGGGCCAGG + Intergenic
1040422263 8:47251644-47251666 TCCCCCCAGTTCCCAAGCACAGG - Intergenic
1040444745 8:47482351-47482373 AACCTCCAGCTCCCGGGCTCAGG - Intronic
1044820595 8:96153487-96153509 ACCCCCCAGGTCCCGGCCCCAGG - Intronic
1045246444 8:100445495-100445517 ACCCCACCCCTCCCTGGCCCAGG - Intergenic
1048967784 8:139626668-139626690 AGCCCACAGTTCCCTGGGACAGG + Intronic
1049219022 8:141420450-141420472 ACCCCAAAGCTCCCAGGCAAAGG - Intronic
1049479066 8:142811362-142811384 ACCCCACATTCCCCTGGCACAGG - Intergenic
1049605750 8:143528490-143528512 GCCTCCCAGCAGCCTGGCACAGG + Intronic
1051863354 9:21651475-21651497 AACTCCCATCTCCCTGGGACAGG - Intergenic
1057031875 9:91782164-91782186 AAGCCTCAGCTCCCTGTCACAGG - Intronic
1057695293 9:97318691-97318713 AACTCCCAGCTCTCTGGCCCTGG + Intronic
1057695368 9:97319102-97319124 AACTCCCAGCTCTCTGGCCCTGG - Intronic
1057729632 9:97597405-97597427 CCCACCCGGCCCCCTGGCACTGG - Intronic
1059025716 9:110626631-110626653 ACCCCCAACCTCTCTGGAACCGG + Intergenic
1059216314 9:112567195-112567217 ACTCCCCAGCTCCCTAAGACAGG + Intronic
1060182172 9:121541842-121541864 CCCCACCAGCTCCCTGGCTCTGG - Intergenic
1060667144 9:125438762-125438784 AGCCCCTGGCTCACTGGCACAGG - Exonic
1060725804 9:126005212-126005234 ACCCTTCAGCTCCCTGACCCAGG + Intergenic
1060727306 9:126015013-126015035 TCTCCCCAGCTCCCTGGCTCGGG - Intergenic
1060891240 9:127189849-127189871 AGCCCCCTGGTCCGTGGCACAGG + Intronic
1061223951 9:129269661-129269683 AACCTCCACCTCCCTGGCTCAGG + Intergenic
1061293029 9:129663133-129663155 AAGCCCCAGCTCCCTGACAGTGG - Intergenic
1061765517 9:132878784-132878806 CCCTCCCAGCTCCCCGGCTCTGG + Intronic
1061784489 9:133018354-133018376 ACCCTCCACCTCCCGGGCTCTGG - Intergenic
1062038498 9:134393315-134393337 ACCTCCCAGCTGCCTGGCCCAGG + Intronic
1062431496 9:136528632-136528654 ACACCCCGGCTCCCTGGGAAGGG + Intronic
1062534973 9:137017407-137017429 AGCCCCCTGGACCCTGGCACGGG - Intronic
1062581710 9:137231827-137231849 ACCACCCACCCCCCAGGCACTGG + Intronic
1185633887 X:1537350-1537372 ACCGCCCACCTCCCTATCACTGG + Intergenic
1186386070 X:9111498-9111520 ACCCTCCAACTCCGAGGCACTGG - Intronic
1187915498 X:24149638-24149660 GCGGCCCAGCTCCCCGGCACGGG - Intronic
1189348466 X:40260083-40260105 GCTCCCCACCTCCCTGGAACTGG - Intergenic
1193429113 X:81378345-81378367 AGCCTCAACCTCCCTGGCACAGG + Intergenic
1194559585 X:95403918-95403940 AACTCCCATCTCCCTGGGACAGG + Intergenic
1195544483 X:106100050-106100072 ACCCACTAGCACCCTGCCACAGG - Intergenic
1198093746 X:133357300-133357322 ACCCTCCACCTCCCAGGCTCAGG - Intronic
1198528010 X:137521620-137521642 TGCCCGCAGATCCCTGGCACAGG - Intergenic
1198687125 X:139238450-139238472 CCCCCCCAACTCCCTCGCCCCGG + Intergenic
1200001800 X:153065965-153065987 ACCACCCAGCCCACTGCCACCGG + Intergenic
1200418214 Y:2935290-2935312 GCGGCCCAGCTCCCCGGCACGGG - Intronic
1201969390 Y:19774864-19774886 ACCCACCAGCTCCTAGGGACAGG + Intergenic