ID: 1181060009

View in Genome Browser
Species Human (GRCh38)
Location 22:20277931-20277953
Sequence ACTGCTGGTGCGCCCTGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181060009_1181060013 -8 Left 1181060009 22:20277931-20277953 CCCGCTCAGGGCGCACCAGCAGT No data
Right 1181060013 22:20277946-20277968 CCAGCAGTACCCCTCTCTCAGGG 0: 1
1: 1
2: 2
3: 18
4: 196
1181060009_1181060011 -9 Left 1181060009 22:20277931-20277953 CCCGCTCAGGGCGCACCAGCAGT No data
Right 1181060011 22:20277945-20277967 ACCAGCAGTACCCCTCTCTCAGG 0: 1
1: 0
2: 1
3: 10
4: 132
1181060009_1181060014 -2 Left 1181060009 22:20277931-20277953 CCCGCTCAGGGCGCACCAGCAGT No data
Right 1181060014 22:20277952-20277974 GTACCCCTCTCTCAGGGACATGG 0: 1
1: 1
2: 1
3: 8
4: 130
1181060009_1181060018 3 Left 1181060009 22:20277931-20277953 CCCGCTCAGGGCGCACCAGCAGT No data
Right 1181060018 22:20277957-20277979 CCTCTCTCAGGGACATGGCCAGG 0: 2
1: 0
2: 1
3: 27
4: 247
1181060009_1181060019 8 Left 1181060009 22:20277931-20277953 CCCGCTCAGGGCGCACCAGCAGT No data
Right 1181060019 22:20277962-20277984 CTCAGGGACATGGCCAGGCCTGG 0: 2
1: 0
2: 4
3: 49
4: 490
1181060009_1181060020 9 Left 1181060009 22:20277931-20277953 CCCGCTCAGGGCGCACCAGCAGT No data
Right 1181060020 22:20277963-20277985 TCAGGGACATGGCCAGGCCTGGG 0: 2
1: 0
2: 3
3: 53
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181060009 Original CRISPR ACTGCTGGTGCGCCCTGAGC GGG (reversed) Intronic
No off target data available for this crispr