ID: 1181060327

View in Genome Browser
Species Human (GRCh38)
Location 22:20279228-20279250
Sequence CCATCTTTGCAGCCGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181060317_1181060327 4 Left 1181060317 22:20279201-20279223 CCTGCTCCACGGCCAGGACCAGG 0: 2
1: 0
2: 3
3: 32
4: 437
Right 1181060327 22:20279228-20279250 CCATCTTTGCAGCCGGTGAAGGG 0: 1
1: 0
2: 1
3: 8
4: 164
1181060320_1181060327 -2 Left 1181060320 22:20279207-20279229 CCACGGCCAGGACCAGGGCCACC 0: 2
1: 0
2: 6
3: 93
4: 560
Right 1181060327 22:20279228-20279250 CCATCTTTGCAGCCGGTGAAGGG 0: 1
1: 0
2: 1
3: 8
4: 164
1181060316_1181060327 9 Left 1181060316 22:20279196-20279218 CCTTGCCTGCTCCACGGCCAGGA 0: 2
1: 0
2: 1
3: 33
4: 317
Right 1181060327 22:20279228-20279250 CCATCTTTGCAGCCGGTGAAGGG 0: 1
1: 0
2: 1
3: 8
4: 164
1181060321_1181060327 -8 Left 1181060321 22:20279213-20279235 CCAGGACCAGGGCCACCATCTTT 0: 2
1: 0
2: 0
3: 14
4: 212
Right 1181060327 22:20279228-20279250 CCATCTTTGCAGCCGGTGAAGGG 0: 1
1: 0
2: 1
3: 8
4: 164
1181060313_1181060327 16 Left 1181060313 22:20279189-20279211 CCACGCGCCTTGCCTGCTCCACG No data
Right 1181060327 22:20279228-20279250 CCATCTTTGCAGCCGGTGAAGGG 0: 1
1: 0
2: 1
3: 8
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181060327 Original CRISPR CCATCTTTGCAGCCGGTGAA GGG Intronic
900725257 1:4212380-4212402 CAATCTTGGCAGAAGGTGAAAGG + Intergenic
903270175 1:22183220-22183242 CGATCTTAGCAACTGGTGAATGG - Intergenic
905205539 1:36341003-36341025 CCCTCTCTGCTGCCGGTGATGGG - Exonic
907763243 1:57382695-57382717 GGTTCTTTGCAGCCGGGGAAAGG + Intronic
908911486 1:69076829-69076851 CAATCATGGCAGACGGTGAAAGG - Intergenic
908932147 1:69330619-69330641 CCATCATGGCAGAAGGTGAAGGG + Intergenic
911465978 1:98252446-98252468 CAATCTTTGCAGAAGGTAAAAGG - Intergenic
911686119 1:100779792-100779814 CAATCTTTGCAGAAGGTGAAAGG + Intergenic
916359233 1:163949476-163949498 CCATCATGGCAGAAGGTGAAGGG - Intergenic
919930875 1:202221019-202221041 CCATCTCTGCAGCCAGGAAAAGG - Intronic
1063171252 10:3511898-3511920 CCATCTTTGGACCTGGTGCATGG - Intergenic
1063673263 10:8116999-8117021 CCATCTCCGCAGCCGTTAAATGG + Intergenic
1065728791 10:28691827-28691849 CGATCATGGCAGACGGTGAAGGG - Intergenic
1067712682 10:48662478-48662500 CCATCGTTGCAGCTGGGGCAGGG + Intergenic
1068284320 10:54914362-54914384 CAATCATTGCAGAAGGTGAAGGG - Intronic
1069174265 10:65270927-65270949 CCATCTTTGCAGGCGGACATGGG - Intergenic
1075041606 10:119112054-119112076 CCGTCTTTACAGTCTGTGAAGGG - Intronic
1075054674 10:119208236-119208258 CCATCTCGGCAGCTGTTGAAAGG + Intronic
1075421642 10:122305527-122305549 CCATCTTGGCAGAAGGTAAAGGG - Intronic
1076043573 10:127272780-127272802 CCATCATGGCAGAAGGTGAAGGG + Intronic
1076388998 10:130082618-130082640 CAATCATTGCAGAAGGTGAATGG - Intergenic
1078298950 11:10105686-10105708 TCTTCTTTGCAGCCAGGGAAAGG + Intronic
1079858892 11:25642986-25643008 CCAGCTTTGAGGCAGGTGAAAGG - Intergenic
1080089240 11:28325071-28325093 CCATCTTTGCAGACAGAGAGAGG - Intronic
1080575058 11:33591225-33591247 TCCTCTTTGCAGCCTGTGCAAGG + Exonic
1083552003 11:63597158-63597180 CCATCATGGCAGAAGGTGAAGGG - Intronic
1083950690 11:65953931-65953953 CAATCTCTGCAGCTGTTGAATGG + Intronic
1085363278 11:75912392-75912414 CCATGTTTGGGGCCGTTGAAGGG - Intronic
1091324170 11:134671717-134671739 CAATCTTGGCAGAAGGTGAAGGG + Intergenic
1096479591 12:51929832-51929854 CCATCTTTGTAGACGATGTAAGG - Intergenic
1099668590 12:85661067-85661089 CCATCATGGCAGAAGGTGAAAGG - Intergenic
1104414232 12:128584735-128584757 CCATCTGTGCAGCTGGCGAATGG + Intronic
1109196669 13:59385209-59385231 CCATCTTTGCAGGGGAGGAATGG + Intergenic
1109579460 13:64307932-64307954 CCATCATGGCAGAAGGTGAAGGG + Intergenic
1109667708 13:65560149-65560171 CCATCATAGCAGGAGGTGAAAGG + Intergenic
1110385388 13:74904826-74904848 CAATCTTAGCAGAAGGTGAAGGG - Intergenic
1112626621 13:101111770-101111792 CAATCATAGCAGACGGTGAAAGG - Intronic
1112990242 13:105504651-105504673 CCAGCTTGACAGCCCGTGAATGG - Intergenic
1113442305 13:110338660-110338682 CCATCTCTGCAGCTGGGAAAAGG + Intronic
1118039620 14:61902758-61902780 CCATCATGGCAGAAGGTGAAAGG + Intergenic
1121211880 14:92213388-92213410 CCATCATGGCAGAAGGTGAAAGG - Intergenic
1122133559 14:99619978-99620000 CCCTCCTTGAAGCCGGAGAAAGG - Intergenic
1122448488 14:101784443-101784465 CCATCATGGCAGAAGGTGAAGGG + Intronic
1124373230 15:29115233-29115255 CCATCCTTGCAGCCTGTGGGTGG + Intronic
1134811119 16:17167707-17167729 CCATCTTTCCATCTCGTGAATGG + Intronic
1135675835 16:24414151-24414173 CCAGGTTTGCAGCAGGAGAAAGG + Intergenic
1135824706 16:25716433-25716455 CCCTCTTTGCTGTTGGTGAAAGG + Intronic
1136288525 16:29258176-29258198 CCATCTCTCCAGCCCGGGAAGGG - Intergenic
1141376094 16:83532133-83532155 CAATCATGGCAGCAGGTGAAAGG - Intronic
1141918743 16:87120591-87120613 CCATCTTTGCAGCTGGAGAAAGG + Intronic
1143823862 17:9588320-9588342 CCATCTTTGCAGATGGACAAGGG + Intronic
1144230019 17:13192610-13192632 CAATCATGGCAGCAGGTGAAAGG - Intergenic
1149393209 17:56213248-56213270 CCAGCTTTTCAGCCTGTGACGGG - Intronic
1150449646 17:65256189-65256211 CCATCATGGCAGAAGGTGAAAGG - Intergenic
1150470370 17:65432079-65432101 CCATCATGGCAGAAGGTGAAAGG - Intergenic
1150574459 17:66417463-66417485 CCATCCTTGCAGCCTAGGAATGG - Intronic
1151329804 17:73400083-73400105 CCATCTACGCAGCAGGTGGAGGG + Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1156312185 18:35934943-35934965 CAATCATGGCAGCAGGTGAAGGG + Intergenic
1157406463 18:47426025-47426047 CCATCTTTGCAGTCTGTGTGAGG + Intergenic
1157406718 18:47428014-47428036 CCAGCTTTGCAGCTGCTGAATGG - Intergenic
1157888227 18:51389371-51389393 CAATCATGGCAGCAGGTGAAGGG + Intergenic
1158613014 18:58960356-58960378 CCATCTTTACATGGGGTGAAAGG + Intronic
1159841556 18:73404565-73404587 CAATCATTGCAGAAGGTGAAGGG + Intergenic
1160080222 18:75719588-75719610 CCATCATGGCAGAAGGTGAAGGG + Intergenic
1160826899 19:1084513-1084535 CTGTTTTTGCAGCCGGTTAAAGG - Intronic
1160912012 19:1478900-1478922 CCATCTCTGAAGGCGGGGAAGGG + Exonic
925447803 2:3942845-3942867 CCATCTGGGGACCCGGTGAAGGG - Intergenic
928196524 2:29220319-29220341 CAATCATTGCAGAAGGTGAAGGG - Intronic
929471738 2:42200582-42200604 CCATCTTTTCAACTGGAGAAAGG - Intronic
929894320 2:45945308-45945330 CGATCATGGCAGACGGTGAAGGG + Intronic
933713413 2:85343863-85343885 CCATCCCTGCAGTCAGTGAATGG - Intronic
934055129 2:88244945-88244967 CAATCTTGGCAGAAGGTGAAAGG - Intergenic
936800164 2:116256971-116256993 CCATCATGGCAGAAGGTGAAGGG + Intergenic
938730635 2:134144295-134144317 CCATCATGGCAGAAGGTGAAGGG + Intronic
941501537 2:166284580-166284602 CCACCAATGCTGCCGGTGAACGG - Exonic
945209253 2:207365247-207365269 CTATCTTTGCAGATGCTGAAGGG + Intergenic
946033230 2:216721713-216721735 CCAGCTTTGCAGCCCTGGAATGG + Intergenic
948121318 2:235532820-235532842 CCCTCCTGGCAGCCGGTGCATGG + Intronic
948975807 2:241463210-241463232 CCCTCTTTGTAGGCGGTGACTGG + Intronic
1175090775 20:56501991-56502013 CCATATCTGCAGCCTTTGAAAGG + Intronic
1175736101 20:61388349-61388371 CCCACTTTGGAGCCGATGAAGGG - Intronic
1175942063 20:62541981-62542003 TCATCTTTGCAGGGGGTGAGTGG - Intergenic
1177327630 21:19612737-19612759 CCATCTTGGCAGAAGGTGAAGGG - Intergenic
1177869692 21:26556587-26556609 CAATCATGGCAGACGGTGAAGGG + Intronic
1178939628 21:36894181-36894203 CAATCGTTGCAGAAGGTGAAGGG - Intronic
1179288096 21:39995334-39995356 CCATCTCTGCAGCCGTTGCTGGG - Intergenic
1180841171 22:18959566-18959588 CCATCTTTGTAGCCTGTGAGGGG - Intergenic
1181060327 22:20279228-20279250 CCATCTTTGCAGCCGGTGAAGGG + Intronic
949773247 3:7601933-7601955 CCATCTCTGCAGCCGAGGAGAGG + Intronic
950501753 3:13368485-13368507 ACATTTATGCAGCCTGTGAATGG + Intronic
951599900 3:24362213-24362235 ACAGCTTTGCAGACTGTGAAAGG - Intronic
951809065 3:26679506-26679528 CAATCTTTGAAGACAGTGAAAGG - Intronic
952246970 3:31605596-31605618 CAATCTTGGCAGAAGGTGAAAGG - Intronic
953973155 3:47362641-47362663 CCATCATGGCAGAAGGTGAAAGG - Intergenic
954596088 3:51826236-51826258 CAAACATTGCAGACGGTGAAGGG + Intronic
955900287 3:63746559-63746581 CCTTCTTTGCAGCTAGTAAAAGG + Intergenic
956251275 3:67237013-67237035 TCATCTTTGCAGCTGGTTATTGG - Intergenic
957996495 3:87696590-87696612 CCATCTTTGCAGACAGACAATGG - Intergenic
960041913 3:113158522-113158544 CCATCTTTGGAGCATGAGAAGGG + Intergenic
960505773 3:118491614-118491636 CCATCCCTGCAGCCTCTGAAGGG - Intergenic
962327714 3:134449676-134449698 CCATGTTGGCAGCCAGTGGAAGG + Intergenic
962770908 3:138609211-138609233 CCACCTTTGCCGGCGGTGAGCGG - Intronic
964975639 3:162615720-162615742 CAATCGTGGCAGACGGTGAAAGG - Intergenic
965351416 3:167616165-167616187 CTATCCTTGCAGCTGGTAAAGGG + Intronic
966052156 3:175632342-175632364 CAATCTTGGCAGAAGGTGAAGGG - Intronic
968946747 4:3668933-3668955 CCATCTGGGCACCAGGTGAACGG - Intergenic
969041060 4:4296533-4296555 CAATCTTGGCAGAAGGTGAAAGG - Intronic
972296649 4:37745646-37745668 CCATCATGGCAGAAGGTGAAGGG + Intergenic
976911183 4:90308234-90308256 CCAACTTTGCAGCCTGAGAAAGG - Exonic
978256104 4:106694454-106694476 CAATCTTGGCAGAAGGTGAAAGG - Intergenic
979078530 4:116304627-116304649 CCATCATGGCAGAAGGTGAAAGG - Intergenic
980325118 4:131333406-131333428 TCATCTTTGGAGCCAGTGATAGG + Intergenic
981646191 4:147001472-147001494 CAATCATTGCAGAAGGTGAAGGG + Intergenic
983489060 4:168367411-168367433 CCATCATGGCAGAAGGTGAAAGG - Intronic
984115939 4:175681697-175681719 CCATCATAGCAGAAGGTGAAGGG - Intronic
985786020 5:1895321-1895343 CCATCATGGCAGAAGGTGAAAGG - Intergenic
986268089 5:6207756-6207778 CCACCTCTGCTGCCAGTGAAGGG + Intergenic
986739814 5:10696141-10696163 CCTTCTTTGCATCCAGGGAAAGG - Intronic
986860480 5:11921348-11921370 CCATCATGGCAGAAGGTGAAAGG - Intergenic
989434810 5:41398375-41398397 CAATCATTGCAGAAGGTGAAGGG - Intronic
990131836 5:52595613-52595635 CAATCATAGCAGACGGTGAAGGG - Intergenic
991007195 5:61840971-61840993 CCATGCTTGCAGGAGGTGAATGG - Intergenic
991562834 5:67972611-67972633 CAATCTTGGCAGAAGGTGAAGGG + Intergenic
992375141 5:76181543-76181565 CAATCTTGGCAGAAGGTGAAGGG + Intronic
994354871 5:98783466-98783488 CCCTCTCTGGAGCCTGTGAAGGG - Intronic
994785533 5:104156574-104156596 CAATCTTTGCAAAAGGTGAAGGG - Intergenic
995457988 5:112372222-112372244 GCATCTTTTCACACGGTGAAAGG + Intronic
999624879 5:153510063-153510085 CCATCTTGGCAGATGGTAAAAGG - Intronic
1001038432 5:168314769-168314791 CTCTCTCTGCAGCCCGTGAATGG - Intronic
1001132234 5:169073761-169073783 CAATCATTGCAGAAGGTGAAGGG - Intronic
1003008676 6:2405813-2405835 CAATCTTGGCAGAAGGTGAATGG + Intergenic
1004296411 6:14415863-14415885 CCATCATGGCAGAAGGTGAAGGG - Intergenic
1005167208 6:22938423-22938445 CCATCATGGCAGAAGGTGAAGGG + Intergenic
1007627424 6:43254453-43254475 ACAGCTCTGCAGCTGGTGAAGGG - Intronic
1012295071 6:97512310-97512332 CAATCATTGCAGAAGGTGAAGGG + Intergenic
1012560335 6:100572297-100572319 CCATGTTTGCACCAGGAGAAAGG + Intronic
1014449242 6:121564556-121564578 CAATCCTGGCAGACGGTGAAGGG - Intergenic
1015917004 6:138227708-138227730 CCATCCGTGGAGCCTGTGAAAGG - Intronic
1016249812 6:142027366-142027388 CAATCATGGCAGACGGTGAAAGG - Intergenic
1018974091 6:168551189-168551211 CCATCATGGCAGAAGGTGAAGGG - Intronic
1019798576 7:3070941-3070963 CGATCATGGCAGCGGGTGAAGGG + Intergenic
1021296809 7:18918236-18918258 CCATGTTTGCAGAGGGAGAATGG + Intronic
1022026793 7:26455625-26455647 CCATCTCAGGAGCTGGTGAATGG - Intergenic
1023123789 7:36935263-36935285 CCATCATGGCAGAAGGTGAAAGG - Intronic
1023235308 7:38080602-38080624 CAATCTTGGCAGAAGGTGAAGGG + Intergenic
1026463577 7:70634994-70635016 CCCTCTTTACAGATGGTGAAGGG - Intronic
1031758607 7:125681523-125681545 CCATCTTGGCAGTTGGGGAAGGG - Intergenic
1033011530 7:137627563-137627585 CCATCTTTGCAGTGGCTGTAGGG - Intronic
1033129346 7:138732440-138732462 CCATCTTGGCATCCAGTGGAGGG - Intronic
1038437587 8:27546933-27546955 CAATCATGGCAGACGGTGAAGGG + Intergenic
1042203715 8:66307125-66307147 CCTTCCTTGCAGCTGGTGAATGG + Intergenic
1042752990 8:72178777-72178799 CAATCATTGCAGAAGGTGAAGGG + Intergenic
1045485929 8:102631192-102631214 CCATCATTACAGCAGCTGAATGG - Intergenic
1046883056 8:119331603-119331625 CAATCATGGCAGACGGTGAATGG + Intergenic
1048839511 8:138552396-138552418 CAATCATGGCAGACGGTGAAGGG - Intergenic
1049377885 8:142297649-142297671 CCATCTTTGCAGCCTGCGCAGGG - Intronic
1049871645 8:144983428-144983450 CAATCATAGCAGCAGGTGAAGGG - Intergenic
1051889258 9:21925939-21925961 TCATCTTTGCTGCCTGTGAGGGG + Intronic
1052999007 9:34567055-34567077 CCATCTTTGGAGCAGTTGCATGG - Intronic
1055058046 9:72041527-72041549 CTGTCTTTGCAGACGGTGGAAGG + Intergenic
1055168034 9:73220212-73220234 CCATCCTGGCAGAAGGTGAAAGG - Intergenic
1057806918 9:98226020-98226042 CCATCTTCCCAGCTGATGAATGG + Intronic
1058498881 9:105590899-105590921 CAATCGTGGCAGCAGGTGAAGGG + Intronic
1061732848 9:132629961-132629983 CCATCTTCGCAGCTTCTGAAAGG - Intronic
1186309954 X:8307000-8307022 TCATCTTTGCGGCCAATGAAAGG - Intergenic
1186551689 X:10512641-10512663 CCATCTTTGCAGGTGTTGGAAGG - Intronic
1187177060 X:16905310-16905332 CAATCATGGCAGACGGTGAAGGG - Intergenic
1188674094 X:32917214-32917236 CAATCTTGGCAGAAGGTGAAGGG - Intronic
1188959441 X:36471995-36472017 CAATCATGGCAGCAGGTGAAGGG - Intergenic
1189535586 X:41932019-41932041 CTATCTTTCCACCCTGTGAATGG - Intergenic
1192919903 X:75695787-75695809 CAATCATTGCAGAAGGTGAAAGG + Intergenic
1196653878 X:118196959-118196981 CCTTCCTTCCAGCCTGTGAATGG - Intergenic
1197169125 X:123411646-123411668 CCATGTTTGCAACTGGTGAGTGG + Intronic