ID: 1181061832

View in Genome Browser
Species Human (GRCh38)
Location 22:20285457-20285479
Sequence ATGGCTGAGGGCCTGTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181061822_1181061832 9 Left 1181061822 22:20285425-20285447 CCATACACCGGGAGCCTTGTGTG No data
Right 1181061832 22:20285457-20285479 ATGGCTGAGGGCCTGTTTGGGGG No data
1181061820_1181061832 16 Left 1181061820 22:20285418-20285440 CCTTTGCCCATACACCGGGAGCC No data
Right 1181061832 22:20285457-20285479 ATGGCTGAGGGCCTGTTTGGGGG No data
1181061819_1181061832 17 Left 1181061819 22:20285417-20285439 CCCTTTGCCCATACACCGGGAGC No data
Right 1181061832 22:20285457-20285479 ATGGCTGAGGGCCTGTTTGGGGG No data
1181061816_1181061832 27 Left 1181061816 22:20285407-20285429 CCAGTGTCAACCCTTTGCCCATA No data
Right 1181061832 22:20285457-20285479 ATGGCTGAGGGCCTGTTTGGGGG No data
1181061821_1181061832 10 Left 1181061821 22:20285424-20285446 CCCATACACCGGGAGCCTTGTGT No data
Right 1181061832 22:20285457-20285479 ATGGCTGAGGGCCTGTTTGGGGG No data
1181061825_1181061832 -5 Left 1181061825 22:20285439-20285461 CCTTGTGTGTCCATACTCATGGC No data
Right 1181061832 22:20285457-20285479 ATGGCTGAGGGCCTGTTTGGGGG No data
1181061823_1181061832 2 Left 1181061823 22:20285432-20285454 CCGGGAGCCTTGTGTGTCCATAC No data
Right 1181061832 22:20285457-20285479 ATGGCTGAGGGCCTGTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181061832 Original CRISPR ATGGCTGAGGGCCTGTTTGG GGG Intergenic
No off target data available for this crispr