ID: 1181064721

View in Genome Browser
Species Human (GRCh38)
Location 22:20299959-20299981
Sequence CAGGCTGCGCGCCAGCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181064721_1181064725 14 Left 1181064721 22:20299959-20299981 CCTGGGAGCTGGCGCGCAGCCTG No data
Right 1181064725 22:20299996-20300018 CTGCGCCTGGCCCGCGCTGCTGG No data
1181064721_1181064729 29 Left 1181064721 22:20299959-20299981 CCTGGGAGCTGGCGCGCAGCCTG No data
Right 1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG No data
1181064721_1181064724 1 Left 1181064721 22:20299959-20299981 CCTGGGAGCTGGCGCGCAGCCTG No data
Right 1181064724 22:20299983-20300005 TGGTGCTGCGCTTCTGCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181064721 Original CRISPR CAGGCTGCGCGCCAGCTCCC AGG (reversed) Intergenic
No off target data available for this crispr