ID: 1181064723

View in Genome Browser
Species Human (GRCh38)
Location 22:20299978-20300000
Sequence CGCAGAAGCGCAGCACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181064723_1181064735 29 Left 1181064723 22:20299978-20300000 CCTGCTGGTGCTGCGCTTCTGCG No data
Right 1181064735 22:20300030-20300052 CAGGTGCGCGGGGTGCAGCCGGG No data
1181064723_1181064734 28 Left 1181064723 22:20299978-20300000 CCTGCTGGTGCTGCGCTTCTGCG No data
Right 1181064734 22:20300029-20300051 GCAGGTGCGCGGGGTGCAGCCGG No data
1181064723_1181064729 10 Left 1181064723 22:20299978-20300000 CCTGCTGGTGCTGCGCTTCTGCG No data
Right 1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG No data
1181064723_1181064736 30 Left 1181064723 22:20299978-20300000 CCTGCTGGTGCTGCGCTTCTGCG No data
Right 1181064736 22:20300031-20300053 AGGTGCGCGGGGTGCAGCCGGGG No data
1181064723_1181064730 17 Left 1181064723 22:20299978-20300000 CCTGCTGGTGCTGCGCTTCTGCG No data
Right 1181064730 22:20300018-20300040 GCGCGCCACGAGCAGGTGCGCGG No data
1181064723_1181064731 18 Left 1181064723 22:20299978-20300000 CCTGCTGGTGCTGCGCTTCTGCG No data
Right 1181064731 22:20300019-20300041 CGCGCCACGAGCAGGTGCGCGGG No data
1181064723_1181064725 -5 Left 1181064723 22:20299978-20300000 CCTGCTGGTGCTGCGCTTCTGCG No data
Right 1181064725 22:20299996-20300018 CTGCGCCTGGCCCGCGCTGCTGG No data
1181064723_1181064732 19 Left 1181064723 22:20299978-20300000 CCTGCTGGTGCTGCGCTTCTGCG No data
Right 1181064732 22:20300020-20300042 GCGCCACGAGCAGGTGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181064723 Original CRISPR CGCAGAAGCGCAGCACCAGC AGG (reversed) Intergenic
No off target data available for this crispr