ID: 1181064729 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:20300011-20300033 |
| Sequence | GCTGCTGGCGCGCCACGAGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1181064721_1181064729 | 29 | Left | 1181064721 | 22:20299959-20299981 | CCTGGGAGCTGGCGCGCAGCCTG | No data | ||
| Right | 1181064729 | 22:20300011-20300033 | GCTGCTGGCGCGCCACGAGCAGG | No data | ||||
| 1181064723_1181064729 | 10 | Left | 1181064723 | 22:20299978-20300000 | CCTGCTGGTGCTGCGCTTCTGCG | No data | ||
| Right | 1181064729 | 22:20300011-20300033 | GCTGCTGGCGCGCCACGAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1181064729 | Original CRISPR | GCTGCTGGCGCGCCACGAGC AGG | Intergenic | ||
| No off target data available for this crispr | |||||