ID: 1181064729

View in Genome Browser
Species Human (GRCh38)
Location 22:20300011-20300033
Sequence GCTGCTGGCGCGCCACGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181064721_1181064729 29 Left 1181064721 22:20299959-20299981 CCTGGGAGCTGGCGCGCAGCCTG No data
Right 1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG No data
1181064723_1181064729 10 Left 1181064723 22:20299978-20300000 CCTGCTGGTGCTGCGCTTCTGCG No data
Right 1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181064729 Original CRISPR GCTGCTGGCGCGCCACGAGC AGG Intergenic
No off target data available for this crispr