ID: 1181064983

View in Genome Browser
Species Human (GRCh38)
Location 22:20301244-20301266
Sequence CCTTGTGGCCAGGATGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181064975_1181064983 -3 Left 1181064975 22:20301224-20301246 CCATGCAGAAGCCATGCCCACCT No data
Right 1181064983 22:20301244-20301266 CCTTGTGGCCAGGATGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181064983 Original CRISPR CCTTGTGGCCAGGATGTAGT GGG Intergenic
No off target data available for this crispr