ID: 1181065750

View in Genome Browser
Species Human (GRCh38)
Location 22:20305147-20305169
Sequence CACCACAAGGAGAGGGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181065743_1181065750 -5 Left 1181065743 22:20305129-20305151 CCACGCGGAGCCTTAAAACACCA No data
Right 1181065750 22:20305147-20305169 CACCACAAGGAGAGGGGGTCTGG No data
1181065740_1181065750 22 Left 1181065740 22:20305102-20305124 CCACAGAGTGCTTGGTGGGACAG No data
Right 1181065750 22:20305147-20305169 CACCACAAGGAGAGGGGGTCTGG No data
1181065742_1181065750 -4 Left 1181065742 22:20305128-20305150 CCCACGCGGAGCCTTAAAACACC No data
Right 1181065750 22:20305147-20305169 CACCACAAGGAGAGGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181065750 Original CRISPR CACCACAAGGAGAGGGGGTC TGG Intergenic
No off target data available for this crispr