ID: 1181065999

View in Genome Browser
Species Human (GRCh38)
Location 22:20306344-20306366
Sequence CCTCTCATGCAGGGCCGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181065999_1181066014 17 Left 1181065999 22:20306344-20306366 CCCTCCCGGCCCTGCATGAGAGG No data
Right 1181066014 22:20306384-20306406 ACACTAAGAGAGGTTTAGCCTGG No data
1181065999_1181066010 -7 Left 1181065999 22:20306344-20306366 CCCTCCCGGCCCTGCATGAGAGG No data
Right 1181066010 22:20306360-20306382 TGAGAGGGTTCCCGTGGGCTGGG No data
1181065999_1181066015 18 Left 1181065999 22:20306344-20306366 CCCTCCCGGCCCTGCATGAGAGG No data
Right 1181066015 22:20306385-20306407 CACTAAGAGAGGTTTAGCCTGGG No data
1181065999_1181066013 7 Left 1181065999 22:20306344-20306366 CCCTCCCGGCCCTGCATGAGAGG No data
Right 1181066013 22:20306374-20306396 TGGGCTGGGAACACTAAGAGAGG No data
1181065999_1181066016 25 Left 1181065999 22:20306344-20306366 CCCTCCCGGCCCTGCATGAGAGG No data
Right 1181066016 22:20306392-20306414 AGAGGTTTAGCCTGGGCCTCAGG No data
1181065999_1181066018 29 Left 1181065999 22:20306344-20306366 CCCTCCCGGCCCTGCATGAGAGG No data
Right 1181066018 22:20306396-20306418 GTTTAGCCTGGGCCTCAGGGTGG No data
1181065999_1181066009 -8 Left 1181065999 22:20306344-20306366 CCCTCCCGGCCCTGCATGAGAGG No data
Right 1181066009 22:20306359-20306381 ATGAGAGGGTTCCCGTGGGCTGG No data
1181065999_1181066017 26 Left 1181065999 22:20306344-20306366 CCCTCCCGGCCCTGCATGAGAGG No data
Right 1181066017 22:20306393-20306415 GAGGTTTAGCCTGGGCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181065999 Original CRISPR CCTCTCATGCAGGGCCGGGA GGG (reversed) Intergenic
No off target data available for this crispr