ID: 1181066345

View in Genome Browser
Species Human (GRCh38)
Location 22:20307813-20307835
Sequence ATGGAGCTGGCTCACCGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181066334_1181066345 17 Left 1181066334 22:20307773-20307795 CCTGGCCCCACAGGATGCCTATG No data
Right 1181066345 22:20307813-20307835 ATGGAGCTGGCTCACCGTGAGGG No data
1181066333_1181066345 18 Left 1181066333 22:20307772-20307794 CCCTGGCCCCACAGGATGCCTAT No data
Right 1181066345 22:20307813-20307835 ATGGAGCTGGCTCACCGTGAGGG No data
1181066335_1181066345 12 Left 1181066335 22:20307778-20307800 CCCCACAGGATGCCTATGACAAT No data
Right 1181066345 22:20307813-20307835 ATGGAGCTGGCTCACCGTGAGGG No data
1181066337_1181066345 10 Left 1181066337 22:20307780-20307802 CCACAGGATGCCTATGACAATGT No data
Right 1181066345 22:20307813-20307835 ATGGAGCTGGCTCACCGTGAGGG No data
1181066336_1181066345 11 Left 1181066336 22:20307779-20307801 CCCACAGGATGCCTATGACAATG No data
Right 1181066345 22:20307813-20307835 ATGGAGCTGGCTCACCGTGAGGG No data
1181066339_1181066345 0 Left 1181066339 22:20307790-20307812 CCTATGACAATGTGACCCTGGAC No data
Right 1181066345 22:20307813-20307835 ATGGAGCTGGCTCACCGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181066345 Original CRISPR ATGGAGCTGGCTCACCGTGA GGG Intergenic
No off target data available for this crispr